Effects of surface nanomorphology on the senescence of periodontal ligament stem cells

doi:10.7518/hxkq.2024.2023244

Abstract

Abstract:

Objective The effect of TiO₂ nanotube morphology on the differentiation potency of senescent periodontal ligament stem cells was investigated. Methods Two types of titanium sheets with TiO₂nanotube morphology (20V-NT and 70V-NT) were prepared via anodic oxidation at 20 and 70 V separately, and their surface morphology was observed. Young periodontal ligament stem cells were cultivated in an osteogenic induction medium, and the most effective surface morphology in promoting osteogenic differentiation was selected. RO3306 and Nutlin-3a were used to induce the aging of young periodontal ligament stem cells, and senescent periodontal ligament stem cells were obtained. The osteogenic differentiation of senescent periodontal ligament stem cells was induced, and the effect of surface morphology on osteogenic differentiation was observed. Results Nanotube morphology was achieved on the surfaces of titanium sheets through anodic oxidation, and the diameters of the nanotubes increased with voltage. A significant difference in the effect of nanotube morphology was found among nanotubes with different diameters in the young periodontal ligament stem cells. The surface nanotube morphology of 20V-NT had a more significant effect that promoted osteogenic differentiation. Compared with a smooth titanium sheet, the surface nanotube morphology of 20V-NT increased the number of alkaline phosphatase-positive senescent periodontal ligament stem cells and promoted calcium deposition and the expression of osteogenic marker genes Runt-related transcription factor 2, osteopontin, and osteocalcin. Conclusion A special nanotube morphology enhances the differentiation ability of senescent periodontal ligament stem cells, provides an effective method for periodontal regeneration, and further improves the performance of implants.

Key words: surface morphology, titanium, nanotubes, osteogenesis, senescence, periodontal ligament stem cells

CLC Number:

R318.08

Sun Yanping, Liao Li. Effects of surface nanomorphology on the senescence of periodontal ligament stem cells[J]. West China Journal of Stomatology, 2024, 42(2): 172-180.

Figures/Tables 5

Tab 1

Fig 1

Fig 2

Fig 3

Fig 4

References 33

1	Long M, Rack HJ. Titanium alloys in total joint replacement—a materials science perspective[J]. Biomaterials, 1998, 19(18): 1621-1639.
2	Rocca M, Fini M, Giavaresi G, et al. Osteointegration of hydroxyapatite-coated and uncoated titanium screws in long-term ovariectomized sheep[J]. Biomaterials, 2002, 23(4): 1017-1023.
3	Robinson D, Aguilar L, Gatti A, et al. Load response of the natural tooth and dental implant: a comparative biomechanics study[J]. J Adv Prosthodont, 2019, 11(3): 169-178.
4	Pei X, Wang L, Chen C, et al. Contribution of the PDL to osteotomy repair and implant osseointegration[J]. J Dent Res, 2017, 96(8): 909-916.
5	López-Otín C, Blasco MA, Partridge L, et al. The hallmarks of aging[J]. Cell, 2013, 153(6): 1194-1217.
6	López-Otín C, Blasco MA, Partridge L, et al. Hallmarks of aging: an expanding universe[J]. Cell, 2023, 186(2): 243-278.
7	Weng Z, Wang Y, Ouchi T, et al. Mesenchymal stem/stromal cell senescence: hallmarks, mechanisms, and combating strategies[J]. Stem Cells Transl Med, 2022, 11(4): 356-371.
8	Li Y, Wu Q, Wang Y, et al. Senescence of mesenchymal stem cells (review)[J]. Int J Mol Med, 2017, 39(4): 775-782.
9	Doron G, Temenoff JS. Culture substrates for improved manufacture of mesenchymal stromal cell therapies[J]. Adv Healthc Mater, 2021, 10(15): e2100016.
10	Koester J, Miroshnikova YA, Ghatak S, et al. Niche stif-fening compromises hair follicle stem cell potential du-ring ageing by reducing bivalent promoter accessibility[J]. Nat Cell Biol, 2021, 23(7): 771-781.
11	Segel M, Neumann B, Hill MFE, et al. Niche stiffness underlies the ageing of central nervous system progenitor cells[J]. Nature, 2019, 573(7772): 130-134.
12	Rolvien T, Amling M. Disuse osteoporosis: clinical and mechanistic insights[J]. Calcif Tissue Int, 2022, 110(5): 592-604.
13	Liu X, Hou W, He L, et al. AMOT130/YAP pathway in topography-induced BMSC osteoblastic differentiation[J]. Colloids Surf B Biointerfaces, 2019, 182: 110332.
14	Cun X, Hosta-Rigau L. Topography: a biophysical approach to direct the fate of mesenchymal stem cells in tissue engineering applications[J]. Nanomaterials (Basel), 2020, 10(10): 2070.
15	Khudhair D, Bhatti A, Li Y, et al. Anodization parameters influencing the morphology and electrical properties of TiO₂ nanotubes for living cell interfacing and investigations[J]. Mater Sci Eng C Mater Biol Appl, 2016, 59: 1125-1142.
16	Tzaphlidou M. The role of collagen in bone structure: an image processing approach[J]. Micron, 2005, 36(7/8): 593-601.
17	Alves L, Machado V, Botelho J, et al. Enhanced prolife-rative and osteogenic potential of periodontal ligament stromal cells[J]. Biomedicines, 2023, 11(5): 1352.
18	Aydin S, Şahin F. Stem cells derived from dental tissues[J]. Adv Exp Med Biol, 2019, 1144: 123-132.
19	Gao H, Li B, Zhao L, et al. Influence of nanotopography on periodontal ligament stem cell functions and cell sheet based periodontal regeneration[J]. Int J Nanomedicine, 2015, 10: 4009-4027.
20	Johmura Y, Yamanaka T, Omori S, et al. Senolysis by glutaminolysis inhibition ameliorates various age-associated disorders[J]. Science, 2021, 371(6526): 265-270.
21	Sharpless NE, Sherr CJ. Forging a signature of in vivo senescence[J]. Nat Rev Cancer, 2015, 15(7): 397-408.
22	Brammer KS, Frandsen CJ, Jin S. TiO₂ nanotubes for bone regeneration[J]. Trends Biotechnol, 2012, 30(6): 315-322.
23	Cipriano AF, Miller C, Liu H. Anodic growth and biomedical applications of TiO₂ nanotubes[J]. J Biomed Na-notechnol, 2014, 10(10): 2977-3003.
24	Ryu WH, Park CJ, Kwon HS. Synthesis of highly ordered TiO₂ nanotube in malonic acid solution by ano-dization[J]. J Nanosci Nanotechnol, 2008, 8(10): 5467-5470.
25	Brammer KS, Oh S, Cobb CJ, et al. Improved bone-forming functionality on diameter-controlled TiO₂ nanotube surface[J]. Acta Biomater, 2009, 5(8): 3215-3223.
26	Park J, Bauer S, Schlegel KA, et al. TiO₂ nanotube surfaces: 15 nm—an optimal length scale of surface topogra-phy for cell adhesion and differentiation[J]. Small, 2009, 5(6): 666-671.
27	Lv L, Liu Y, Zhang P, et al. The nanoscale geometry of TiO₂ nanotubes influences the osteogenic differentiation of human adipose-derived stem cells by modulating H3-K4 trimethylation[J]. Biomaterials, 2015, 39: 193-205.
28	Brunet A, Goodell MA, Rando TA. Ageing and rejuvenation of tissue stem cells and their niches[J]. Nat Rev Mol Cell Biol, 2023, 24(1): 45-62.
29	Sladitschek-Martens HL, Guarnieri A, Brumana G, et al. YAP/TAZ activity in stromal cells prevents ageing by controlling cGAS-STING[J]. Nature, 2022, 607(7920): 790-798.
30	Elosegui-Artola A, Andreu I, Beedle AEM, et al. Force triggers YAP nuclear entry by regulating transport across nuclear pores[J]. Cell, 2017, 171(6): 1397-1410.
31	Gulati K, Zhang Y, Di P, et al. Research to clinics: clinical translation considerations for anodized nano-engineered titanium implants[J]. ACS Biomater Sci Eng, 2022, 8(10): 4077-4091.
32	Zheng Y, Deng J, Wang G, et al. P53 negatively regulates the osteogenic differentiation in jaw bone marrow MSCs derived from diabetic osteoporosis[J]. Heliyon, 2023, 9(4): e15188.
33	Lotz EM, Cohen DJ, Schwartz Z, et al. Titanium implant surface properties enhance osseointegration in ovariectomy induced osteoporotic rats without pharmacologic intervention[J]. Clin Oral Implants Res, 2020, 31(4): 374-387.

基因	引物（5’-3’）
RUNX2	上游：TGGTTACTGTCATGGCGGGTA
	下游：TCTCAGATCGTTGAACCTTGCTA
OPN	上游：GAAGTTTCGCAGACCTGACAT
	下游：GTATGCACCATTCAACTCCTCG
OCN	上游：CACTCCTCGCCCTATTGGC
	下游：CCCTCCTGCTTGGACACAAAG
BMP2	上游：ACCCGCTGTCTTCTAGCGT
	下游：TTTCAGGCCGAACATGCTGAG
MKI67	上游：TCCTTTGGTGGGCACCTAAGACCTG
	下游：TGATGGTTGAGGTCGTTCCTTGATG
GAPDH	上游：CTTTGGTATCGTGGAAGGACTC
	下游：GTAGAGGCAGGGATGATGTTCT

[1]	Tang Xiaoxue, Zhou Zheng, Li Qiqi, Jiang Dandan. Effects of sitagliptin activation of the stromal cell-derived factor-1/CXC chemokine receptor 4 signaling pathway on the proliferation, apoptosis, inflammation, and osteogenic differentiation of human periodontal ligament stem cells induced by lipopolysaccharide [J]. West China Journal of Stomatology, 2024, 42(1): 37-45.
[2]	Li Shenghong, Peng Shiyuan, Luo Xiaoling, Wang Yipei, Xu Xiaomei. Effect of naringenin on the anti-inflammatory, vascularization, and osteogenesis differentiation of human periodontal ligament stem cells via the stromal cell-derived factor 1/C-X-C motif chemokine receptor 4 signaling axis stimulated by lipopolysaccharide [J]. West China Journal of Stomatology, 2023, 41(2): 175-184.
[3]	Dai Zhenning, Zheng Weihan, Li Shiyu. Receptor activator of nuclear factor-κB ligand and tumor necrosis factor-α promotes osteoclast differentiation through the exosomes of inflammatory periodontal ligament stem cells [J]. West China Journal of Stomatology, 2022, 40(4): 377-385.
[4]	Zhang Min, Ao Xiaogang, Zheng Zheng, Chen Wenchuan.. Promoting the adhesion of human gingival epithelial cells on titanium surface by non-thermal atmospheric plasma irradiation [J]. West China Journal of Stomatology, 2022, 40(3): 285-292.
[5]	Pang Ming, Wei Hongxia, Chen Xi. Long non-coding RNA potassium voltage-gated channel subfamily Q member 1 overlapping transcript 1 regulates the proliferation and osteogenic differentiation of human periodontal ligament stem cells by targeting miR-24-3p [J]. West China Journal of Stomatology, 2021, 39(5): 547-554.
[6]	Wang Lin, Wang Xi, Ji Nan, Li Haimei, Cai Shixin. Mechanisms of the mechanically activated ion channel Piezo1 protein in mediating osteogenic differentiation of periodontal ligament stem cells via the Notch signaling pathway [J]. West China Journal of Stomatology, 2020, 38(6): 628-636.
[7]	Ao Xiaogang, Chen Wenchuan. Research progress on the osseointegration of titanium implants promoted by cold atmospheric plasma [J]. West China Journal of Stomatology, 2020, 38(5): 566-570.
[8]	Xie Xudong, Zhao Lei, Wu Yafei, Wang Jun. Role of bone morphogenetic protein 1/tolloid proteinase family in the development of teeth and bone [J]. West China Journal of Stomatology, 2020, 38(5): 589-593.
[9]	Lin Yongsheng,Wang Fengzhi,Lei Xiaojing,He Jianmin. Comparative study with the effect of stromal cell derived factor-1 on osteogenic differentiation of human healthy and inflammatory periodontal ligament stem cells [J]. West China Journal of Stomatology, 2019, 37(5): 469-475.
[10]	Yue Wu,Jianfeng Jin. Surface characteristics of pure titanium loaded graphene oxide: effect on bacteria adhesion and osteoblast structure [J]. West China Journal of Stomatology, 2019, 37(4): 366-371.
[11]	Bangcheng Yang,Xuedong Zhou,Haiyang Yu,Yao Wu,Chongyun Bao,Yi Man,Lei Cheng,Yao Sun. Advances in titanium dental implant surface modification [J]. West China Journal of Stomatology, 2019, 37(2): 124-129.
[12]	Jin Sun,Yun Liu,Qian Qu,Juan Qu,Wei Luo,Feng Zhang,Min. Wu. Effect of histone acetylation on osteogenic differentiation of periodontal ligament stem cells derived from periodontitis tissue [J]. West China Journal of Stomatology, 2019, 37(1): 102-105.
[13]	Guijun Sun,Xiaodong Qin,Shiqin Wang,Huizhen Hu,Xiaoyan Lu,Jiajia Jin,Shengrong Wu,Xiangyi He. Construction of human telomerase reverse transcriptase periodontal ligament cell line mediated by adenovirus [J]. West China Journal of Stomatology, 2019, 37(1): 25-30.
[14]	Ting Wei,Xinwei Zhang,Huiqiang Sun,Mengyun Mao. Selective laser sintering and performances of porous titanium implants [J]. West China Journal of Stomatology, 2018, 36(5): 532-538.
[15]	Yang Yao, Yu Du, Xia Gu, Mengkai Guang, Bo Huang, Ping. Gong. Local injection of exogenous nerve growth factor improves early bone maturation of implants [J]. West China Journal of Stomatology, 2018, 36(2): 128-132.