Effect of naringenin on the anti-inflammatory, vascularization, and osteogenesis differentiation of human periodontal ligament stem cells via the stromal cell-derived factor 1/C-X-C motif chemokine receptor 4 signaling axis stimulated by lipopolysaccharide

doi:10.7518/hxkq.2023.2022293

Abstract

Abstract:

Objective This study aimed to investigate how naringenin (Nar) affected the anti-inflammatory, vascula-rization, and osteogenesis differentiation of human periodontal ligament stem cells (hPDLSCs) stimulated by lipopolysaccharide (LPS) and to preliminarily explore the underlying mechanism. Methods Cell-counting kit-8 (CCK8), cell scratch test, and Transwell assay were used to investigate the proliferation and migratory capabilities of hPDLSCs. Alkaline phosphatase (ALP) staining, alizarin red staining, lumen-formation assay, enzyme-linked immunosorbent assay, quantitative timed polymerase chain reaction, and Western blot were used to measure the expression of osteopontin (OPN), Runt-related transcription factor 2 (RUNX2), vascular endothlial growth factor (VEGF), basic fibroblast growth factor (bFGF), von Willebrand factor (vWF), tumor necrosis factor-α (TNF-α), and interleukin (IL)-6. Results We observed that 10 μmol/L Nar could attenuate the inflammatory response of hPDLSCs stimulated by 10 μg/mL LPS and promoted their proliferation, migration, and vascularization differentiation. Furthermore, 0.1 μmol/L Nar could effectively restore the osteogenic differentiation of inflammatory hPDLSCs. The effects of Nar’s anti-inflammatory and promotion of osteogenic differentiation significantly decreased and inflammatory vascularization differentiation increased after adding AMD3100 (a specific CXCR4 inhibitor). Conclusion Nar demonstrated the ability to promote the anti-inflammatory, vascularization, and osteogenic effects of hPDLSCs stimulated by LPS, and the ability was associated with the stromal cell-derived factor/C-X-C motif chemokine receptor 4 signaling axis.

Key words: naringenin, inflammatory human periodontal ligament stem cells, anti-inflammatory, osteogenesis, vascularization

CLC Number:

Q 257

Li Shenghong, Peng Shiyuan, Luo Xiaoling, Wang Yipei, Xu Xiaomei. Effect of naringenin on the anti-inflammatory, vascularization, and osteogenesis differentiation of human periodontal ligament stem cells via the stromal cell-derived factor 1/C-X-C motif chemokine receptor 4 signaling axis stimulated by lipopolysaccharide[J]. West China Journal of Stomatology, 2023, 41(2): 175-184.

Figures/Tables 5

Tab 1

Fig 1

Fig 2

Fig 3

Fig 4

References 33

1	Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases[J]. Lancet, 2005, 366(9499): 1809-1820.
2	Dye BA. Global periodontal disease epidemiology[J]. Periodontol 2000, 2012, 58(1): 10-25.
3	Ivanovski S, Vaquette C, Gronthos S, et al. Multiphasic scaffolds for periodontal tissue engineering[J]. J Dent Res, 2014, 93(12): 1212-1221.
4	Park CH, Kim KH, Lee YM, et al. Advanced enginee-ring strategies for periodontal complex regeneration[J]. Materials (Basel), 2016, 9(1): 57.
5	Bright R, Hynes K, Gronthos S, et al. Periodontal ligament-derived cells for periodontal regeneration in animal models:a systematic review[J]. J Periodontal Res, 2015, 50(2): 160-172.
6	Owaki T, Shimizu T, Yamato M, et al. Cell sheet engineering for regenerative medicine: current challenges and strategies[J]. Biotechnol J, 2014, 9(7): 904-914.
7	Xu XY, Li X, Wang J, et al. Concise review: periodontal tissue regeneration using stem cells: strategies and translational considerations[J]. Stem Cells Transl Med, 2019, 8(4): 392-403.
8	Xia Y, Tang HN, Wu RX, et al. Cell Responses to conditioned media produced by patient-matched stem cells derived from healthy and inflamed periodontal ligament tissues[J]. J Periodontol, 2016, 87(5): e53-e63.
9	Tang HN, Xia Y, Yu Y, et al. Stem cells derived from “inflamed” and healthy periodontal ligament tissues and their sheet functionalities:a patient-matched comparison[J]. J Clin Periodontol, 2016, 43(1): 72-84.
10	Mulvihill EE, Burke AC, Huff MW. Citrus flavonoids as regulators of lipoprotein metabolism and atherosclerosis[J]. Annu Rev Nutr, 2016, 36: 275-299.
11	Jin L, Zeng W, Zhang F, et al. Naringenin ameliorates acute inflammation by regulating intracellular cytokine degradation[J]. J Immunol, 2017, 199(10): 3466-3477.
12	Du G, Jin L, Han X, et al. Naringenin: a potential immunomodulator for inhibiting lung fibrosis and metastasis[J]. Cancer Res, 2009, 69(7): 3205-3212.
13	Bodet C, La VD, Epifano F, et al. Naringenin has anti-inflammatory properties in macrophage and ex vivo human whole-blood models[J]. J Periodontal Res, 2008, 43(4): 400-407.
14	Yu DH, Ma CH, Yue ZQ, et al. Protective effect of naringenin against lipopolysaccharide-induced injury in normal human bronchial epithelium via supperssion of MA-PK signaling[J]. Inflammation, 2015, 38(1): 195-204.
15	Chtourou Y, Fetoui H, Jemai R, et al. Naringenin redu-ces cholesterol-induced hepatic inflammation in rats by modulating matrix metalloproteinases-2, 9 via inhibition of nuclear factor κB pathway[J]. Eur J Pharmacol, 2015, 746: 96-105.
16	Li YR, Chen DY, Chu CL, et al. Naringenin inhibits dendritic cell maturation and has therapeutic effects in a murine model of collagen-induced arthritis[J]. J Nutr Biochem, 2015, 26(12): 1467-1478.
17	Eanes L, Patel YM. Inhibition of the MAPK pathway alone is insufficient to account for all of the cytotoxic effects of naringenin in MCF-7 breast cancer cells[J]. Biochim Open, 2016, 3: 64-71.
18	Zhang L, He H, Zhang M, et al. Assessing the effect and related mechanism of naringenin on the proliferation, osteogenic differentiation and endothelial differentiation of human periodontal ligament stem cells[J]. BiochemBiophys Res Commun, 2021, 534: 337-342.
19	Wang X, Wang C, Gou W, et al. The optimal time to inject bone mesenchymal stem cells for fracture healing in a murine model[J]. Stem Cell Re Ther, 2018, 9(1): 272.
20	Kortesidis A, Zannettino A, Isenmann S, et al. Stromal-derived factor-1 promotes the growth, survival, and development of human bone marrow stromal stem cells[J]. Blood, 2005, 105(10): 3793-3801.
21	Havens AM, Chiu E, Taba M, et al. Stromal-derived factor-1alpha (CXCL12) levels increase in periodontal disease[J]. J Periodontol, 2008, 79(5): 845-853.
22	林永盛, 王丰芝, 雷晓静, 等. 基质细胞衍生因子-1对炎症和正常来源的人牙周膜干细胞成骨分化能力的影响[J]. 华西口腔医学杂志, 2019, 37(5): 469-475.
	Lin YS, Wang FZ, Lei XJ, et al. Comparative study with the effect of stromal cell derived factor-1 on osteogenic differentiation of human healthy and inflammatory pe-riodontal ligament stem cells[J]. West China J Stomatol, 2019, 37(5): 469-475.
23	Pang Y, Yuan X, Guo J, et al. The effect of liraglutide on the proliferation, migration, and osteogenic differentiation of human periodontal ligament cells[J]. J Periodontal Res, 2019, 54(2): 106-114.
24	Zhang P, Zhang Y, Liu Q, et al. 1,25 (OH)₂D₃ supports theosteogenic differentiation of hPDLSCs under inflammatory conditions through inhibiting PLAP-1 expression transcriptionally[J]. Int Immunopharmacol, 2020, 78: 105998.
25	Chen YC, Ninomiya T, Hosoya A, et al. 1α, 25-Dihydroxyvitamin D3 inhibits osteoblastic differentiation of mouse periodontal fibroblasts[J]. Arch Oral Biol, 2012, 57(5): 453-459.
26	Zhang Z, Shuai Y, Zhou F, et al. PDLSCs regulate angiogenesis of periodontal ligaments via VEGF transferred by exosomes in periodontitis[J]. Int J Med Sci, 2020, 17(5): 558-567.
27	Rather HA, Jhala D, Vasita R. Dual functional approa-ches for osteogenesis coupled angiogenesis in bone tissue engineering[J]. Mater Sci Eng C Mater Biol Appl, 2019, 103: 109761.
28	Zoellner H, Hunter N. Vascular expansion in chronic periodontitis[J]. J Oral Pathol Med, 1991, 20(9): 433-437.
29	Mousavi A. CXCL12/CXCR4 signal transduction in di-seases and its moleculear approaches in targeted-therapy[J]. Immunol Lett, 2020, 217: 91-115.
30	Havens AM, Chiu E, Taba M, et al. Stromalderived factor-1alpha (CXCL12) levels increase in periodontal di-sease[J]. J Periodontol, 2008, 79(5): 845-853.
31	Wei K, Xie Y, Chen T, et al. ERK1/2 signaling mediated naringin-induced osteogenic differentiation of immortali-zed human periodontal ligament stem cells[J]. Biochem Biophys Res Commun, 2017, 489(3): 319-325.
32	Wang H, Li C, Li J, et al. Naringin enhances osteogenic differentiation through the activation of ERK signaling in human bone marrow mesenchymal stem cells[J]. Iran J Basic Med Sci, 2017, 20(4): 408-414.
33	Hämäläinen M, Nieminen R, Vuorela P, et al. Anti-inflammatory effects of flavonoids:genistein, kaempferol, quercetin, and daidzein inhibit STAT-1 and NF-kappaB activations, whereas flavone, isorhamnetin, naringenin, and pelargonidin inhibit only NF-kappaB activation a-long with their inhibitory effect on iNOS expression and NO production in activated macrophages[J]. Mediators Inflamm, 2007, 2007: 45673.

基因名称	引物序列（5’-3’）
RUNX2	Forward：GAACCCAGAAGGCACAGACA Reverse：GGCTCAGGTAGGAGGGGTAA
OPN	Forward：CACCGAGACACCATGAGAGC Reverse：CTGCTTGGACACAAAGGCTGC
bFGF	Forward：GCGACCCTCACATCAAGCTA Reverse：AGCCAGGTAACGGTTAGCAC
VEGF	Forward：ATCGAGTACATCTTCAAGCCAT Reverse：GTGAGGTTTGATCCGCATAATC
vWF	Forward：TTGACGGGGAGGTGAATGTG Reverse：ATGTCTGCTTCAGGACCACG
SDF-1	Forward：TGCCCTTCAGATTGTAGCCC Reverse：GTGGGTCTAGCGGAAAGTCC
CXCR4	Forward：CGTGAATGAGTGTCTAGGCAGG Reverse：GGCTTTGGTTTTAAGTGCCATC
TNF-α	Forward：AGCTGGTGGTGCCATCAGAGG Reverse：TGGTAGGAGACGGCGATGCG
IL-6	Forward：CACTGGTCTTTTGGAGTTTGAG Reverse：GGACTTTTGTACTCATCTGCAC
β-actin	Forward：CGACCCGTCTACAGGTGAAC Reverse：GAGAGGGACTCAATCAGCCG

[1]	Xie Xudong, Zhao Lei, Wu Yafei, Wang Jun. Role of bone morphogenetic protein 1/tolloid proteinase family in the development of teeth and bone [J]. West China Journal of Stomatology, 2020, 38(5): 589-593.
[2]	Guijun Sun,Xiaodong Qin,Shiqin Wang,Huizhen Hu,Xiaoyan Lu,Jiajia Jin,Shengrong Wu,Xiangyi He. Construction of human telomerase reverse transcriptase periodontal ligament cell line mediated by adenovirus [J]. West China Journal of Stomatology, 2019, 37(1): 25-30.
[3]	Li Yongdi, Zhu Pengna, Wang Dongxiang, Chen Jiamin, Tang Zhenglong. Osteoprotegerin/receptor activator of nuclear factor-κB ligand expression in mandibular distraction osteogenesis regulated by parathyroid hormone [J]. West China Journal of Stomatology, 2016, 34(3): 234-238.
[4]	Feng Guijuan, Zheng Ke, Song Donghui, Wu Senbin, Zhu Songsong, Hu Jing.. Mesenchymal stem cells modified with Runt-related transcription factor 2 promote bone regeneration in rabbit mandibular distraction osteogenesis [J]. West China Journal of Stomatology, 2016, 34(2): 125-129.
[5]	Li Hao, Zhou Hailun, Wang Qi, Li Wei. Changes in bone marrow mesenchymal stem cells osteogenesis by the regulation of Lnk/stem cell factor-cKit signaling [J]. West China Journal of Stomatology, 2015, 33(6): 633-637.
[6]	Lü Xue, Liu Na, Du Wen, Li Jiayang, Sun Yue, Luo En. Effect of topically applied recombinant adenovirus of adiponectin on bone defect repair [J]. West China Journal of Stomatology, 2015, 33(4): 361-365.
[7]	Zhang Zhiming, Lü Xue, Hu Jian, Wang Jian, Luo En.. Recombinant adenovirus Ad-APN-EGFP constructing and promoting osteogenesis around implants [J]. West China Journal of Stomatology, 2014, 32(5): 488-492.
[8]	Zhou Nuo, Huang Xuanping, Jiang Xianfang, Song Jichuan, Li Hua, Xie Qingtiao. . Experimental study on transplantation of bone morphogenetic protein-2 gene transfected bone mesenchymal stem cells compounded with Pluronic F-127 for promoting bone regeneration in rabbit mandibular distrac-tion osteogenesis [J]. West China Journal of Stomatology, 2013, 31(3): 247-252.
[9]	Li Shouyi, Cai Qingyi, Chen Gang, Zhu Xiaokong, Zhong Xiaomin, Peng Derui. Histological study of dual factor inducing axial vascularization in double-layered scaffold [J]. West China Journal of Stomatology, 2013, 31(2): 205-208.
[10]	Yao Yusheng1, Huang Hua1, Chang Shimin2, Wang Chengyue1, Wang Guijun3.. The effect of bone morphogenetic protein-2 and osteoprotegerin in trans-sutural distraction osteogenesis [J]. West China Journal of Stomatology, 2012, 30(4): 425-429.
[11]	Sun Ming1, Lü Na1, Huang Daiying2, Chen Songling2, Yan Yuchun1, Zhang Lingda1. The impact of changing the buccal position of the transported bone on early bone formation after alveolar vertical distraction [J]. West China Journal of Stomatology, 2011, 29(06): 646-650.
[12]	Zhang Yanxiao, Zhou Hong, Wang Xiaorong. Expression of vascular endothelial growth factor and osteocalcin during distraction osteogenesis of periodontal ligament on rats [J]. West China Journal of Stomatology, 2011, 29(06): 651-654.
[13]	LIU Xue-mei1, LI Yan-feng2, HU Min1, ZHANG Jian-qiang2, LIU Bin2, FAN Li-na3. Discussing displacemental trend on nontractional side of canine mandible with finite element method when distraction osteogenesis with unilateral incomplete osteotomy [J]. West China Journal of Stomatology, 2011, 29(02): 220-222.
[14]	ZHONG Xiao-yi1, YANG Yi-ping2, HEN Wen -xia1, ZHANG Ying -juan1, WEN Chun -mei1. Pulp revascularization of immature anterior teeth with apical periodontitis [J]. West China Journal of Stomatology, 2010, 28(06): 672-674.
[15]	LIU Yi, CHEN Gang, LI Hong-jie, WANG Jian, LIU Yan-shan, WANG Zhi-qi. Bone morphogenetic protein expression in distraction osteogenesis correction for cleft palate in Rhesus monkeys [J]. West China Journal of Stomatology, 2010, 28(04): 425-429.