West China Journal of Stomatology ›› 2017, Vol. 35 ›› Issue (3): 245-252.doi: 10.7518/hxkq.2017.03.004
• Orginal Article • Previous Articles Next Articles
Xi Liang1,2(
), Guoqing Chen2, Wei-dong Tian1,2(
)
Received:2016-12-15
Revised:2017-03-20
Online:2017-06-05
Published:2017-06-01
Supported by:CLC Number:
Xi Liang, Guoqing Chen, Wei-dong Tian. Effect of hypoxia on the biological characteristics of human dental follicle cells[J]. West China Journal of Stomatology, 2017, 35(3): 245-252.
Add to citation manager EndNote|Ris|BibTeX
Tab 1
Primer sequences used for qRT-PCR
| 基因 | 引物序列(5’—3’) |
|---|---|
| β-actin | F:AGCCTCGCCTTTGCCG |
| R:CTCGTCGCCCACATAGGAAT | |
| Nanog | F:TGGACACTGGCTGAATCCTTC |
| R:CGCTGATTAGGCTCCAACCAT | |
| Sox-2 | F:CAGCTCGCAGACCTACATGAAC |
| R:CTGGAGTGGGAGGAAGAGGTAAC | |
| Oct-4 | F:TCCCATGCATTCAAACTGAGG |
| R:CCAAAAACCCTGGCACAAACT | |
| Runx2 | F:CTTTACTTACACCCCGCCAGTC |
| R:AGAGATATGGAGTGCTGCTGGTC | |
| OSX | F:TCAACAACTCTGGGCAAAGCA |
| R:TTAGCATAGCCTGAGGTGGGTG | |
| BSP | F:CGAACAAGGCATAAACGGCACCAG |
| R:TTCTCCATTGTCTCCTCCGCTGCT | |
| OPN | F:CAGTTGTCCCCACAGTAGACAC |
| R:GTGATGTCCTCGTCTGTAGCATC |
| [1] | Morsczeck C, Götz W, Schierholz J, et al.Isolation of pre-cursor cells (PCs) from human dental follicle of wisdom teeth[J]. Matrix Biol, 2005, 24(2):155-165. |
| [2] | Saito M, Handa K, Kiyono T, et al.Immortalization of cemen-toblast progenitor cells with Bmi-1 and TERT[J]. J Bone Miner Res, 2005, 20(1):50-57. |
| [3] | Guo W, Gong K, Shi H, et al.Dental follicle cells and treated dentin matrix scaffold for tissue engineering the tooth root[J]. Biomaterials, 2012, 33(5):1291-1302. |
| [4] | Grayson WL, Zhao F, Izadpanah R, et al.Effects of hypoxia on human mesenchymal stem cell expansion and plasticity in 3D constructs[J]. J Cell Physiol, 2006, 207(2):331-339. |
| [5] | Bosch P, Pratt SL, Stice SL.Isolation, characterization, gene modification, and nuclear reprogramming of porcine mesen-chymal stem cells[J]. Biol Reprod, 2006, 74(1):46-57. |
| [6] | Mazumdar J, Dondeti V, Simon MC.Hypoxia-inducible factors in stem cells and cancer[J]. J Cell Mol Med, 2009, 13(11/12):4319-4328. |
| [7] | Webb JD, Coleman ML, Pugh CW.Hypoxia, hypoxia-in-ducible factors (HIF), HIF hydroxylases and oxygen sensing[J]. Cell Mol Life Sci, 2009, 66(22):3539-3554. |
| [8] | Iida K, Takeda-Kawaguchi T, Tezuka Y, et al.Hypoxia en-hances colony formation and proliferation but inhibits diffe-rentiation of human dental pulp cells[J]. Arch Oral Biol, 2010, 55(9):648-654. |
| [9] | Sakdee JB, White RR, Pagonis TC, et al.Hypoxia-amplified proliferation of human dental pulp cells[J]. J Endod, 2009, 35(6):818-823. |
| [10] | Gong QM, Quan JJ, Jiang HW, et al.Regulation of the stro-mal cell-derived factor-1alpha-CXCR4 axis in human dental pulp cells[J]. J Endod, 2010, 36(9):1499-1503. |
| [11] | Aranha AM, Zhang Z, Neiva KG, et al.Hypoxia enhances the angiogenic potential of human dental pulp cells[J]. J En-dod, 2010, 36(10):1633-1637. |
| [12] | Agata H, Kagami H, Watanabe N, et al.Effect of ischemic culture conditions on the survival and differentiation of porcine dental pulp-derived cells[J]. Differentiation, 2008, 76(9):981-993. |
| [13] | Guo L, Li J, Qiao X, et al.Comparison of odontogenic diffe-rentiation of human dental follicle cells and human dental papilla cells[J]. PLoS ONE, 2013, 8(4):e62332. |
| [14] | Guo S, Guo W, Ding Y, et al.Comparative study of human dental follicle cell sheets and periodontal ligament cell sheets for periodontal tissue regeneration[J]. Cell Transplant, 2013, 22(6):1061-1073. |
| [15] | Li R, Guo W, Yang B, et al.Human treated dentin matrix as a natural scaffold for complete human dentin tissue rege-neration[J]. Biomaterials, 2011, 32(20):4525-4538. |
| [16] | Patil R, Kumar BM, Lee WJ, et al.Multilineage potential and proteomic profiling of human dental stem cells derived from a single donor[J]. Exp Cell Res, 2014, 320(1):92-107. |
| [17] | Sung IY, Son HN, Ullah I, et al.Cardiomyogenic differentia-tion of human dental follicle-derived stem cells by suberoy-lanilide hydroxamic acid and their in vivo homing property[J]. Int J Med Sci, 2016, 13(11):841-852. |
| [18] | Kashyap V, Rezende NC, Scotland KB, et al.Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluri-potency transcription factors with polycomb repressive com-plexes and stem cell microRNAs[J]. Stem Cells Dev, 2009, 18(7):1093-1108. |
| [19] | Park IH, Zhao R, West JA, et al.Reprogramming of human somatic cells to pluripotency with defined factors[J]. Nature, 2008, 451(7175):141-146. |
| [20] | Mathieu J, Zhang Z, Zhou W, et al.HIF induces human em-bryonic stem cell markers in cancer cells[J]. Cancer Res, 2011, 71(13):4640-4652. |
| [21] | Miura M, Gronthos S, Zhao M, et al.SHED: stem cells from human exfoliated deciduous teeth[J]. Proc Natl Acad Sci USA, 2003, 100(10):5807-5812. |
| [22] | Tamaki Y, Nakahara T, Ishikawa H, et al.In vitro analysis of mesenchymal stem cells derived from human teeth and bone marrow[J]. Odontology, 2013, 101(2):121-132. |
| [23] | Kerkis I, Kerkis A, Dozortsev D, et al.Isolation and charac-terization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers[J]. Cells Tissues Organs, 2006, 184(3/4):105-116. |
| [24] | Sheik Mohamed J, Gaughwin PM, Lim B, et al.Conserved long noncoding RNAs transcriptionally regulated by Oct4 and Nanog modulate pluripotency in mouse embryonic stem cells[J]. RNA, 2010, 16(2):324-337. |
| [25] | Brunelle JK, Shroff EH, Perlman H, et al.Loss of Mcl-1 pro-tein and inhibition of electron transport chain together induce anoxic cell death[J]. Mol Cell Biol, 2007, 27(4):1222-1235. |
| [26] | Zhou Y, Fan W, Xiao Y.The effect of hypoxia on the stem-ness and differentiation capacity of PDLC and DPC[J]. Bio-med Res Int, 2014:890675. |
| [27] | Keith B, Simon MC.Hypoxia-inducible factors, stem cells, and cancer[J]. Cell, 2007, 129(3):465-472. |
| [28] | Kanafi MM, Ramesh A, Gupta PK, et al.Influence of hypo-xia, high glucose, and low serum on the growth kinetics of mesenchymal stem cells from deciduous and permanent teeth[J]. Cells Tissues Organs, 2013, 198(3):198-208. |
| [29] | Dai Y, He H, Wise GE, et al.Hypoxia promotes growth of stem cells in dental follicle cell populations[J]. J Biomed Sci Eng, 2011, 4(6):454-461. |
| [30] | Komori T.Runx2, a multifunctional transcription factor in skeletal development[J]. J Cell Biochem, 2002, 87(1):1-8. |
| [31] | Matsubara T, Kida K, Yamaguchi A, et al.BMP2 regulates Osterix through Msx2 and Runx2 during osteoblast differen-tiation[J]. J Biol Chem, 2008, 283(43):29119-29125. |
| [32] | Nakashima K, Zhou X, Kunkel G, et al.The novel zinc finger-containing transcription factor osterix is required for osteo-blast differentiation and bone formation[J]. Cell, 2002, 108(1):17-29. |
| [33] | Huang W, Yang S, Shao J, et al.Signaling and transcrip-tional regulation in osteoblast commitment and differentia-tion[J]. Front Biosci, 2007, 12:3068-3092. |
| [34] | Annabi B, Lee YT, Turcotte S, et al.Hypoxia promotes mu-rine bone-marrow-derived stromal cell migration and tube formation[J]. Stem Cells, 2003, 21(3):337-347. |
| [35] | Leijten J, Georgi N, Moreira Teixeira L, et al.Metabolic pro-gramming of mesenchymal stromal cells by oxygen tension directs chondrogenic cell fate[J]. Proc Natl Acad Sci U S A, 2014, 111(38):13954-13959. |
| [36] | Ren H, Cao Y, Zhao Q, et al.Proliferation and differentiation of bone marrow stromal cells under hypoxic conditions[J]. Biochem Biophys Res Commun, 2006, 347(1):12-21. |
| [37] | Prado-Lòpez S, Duffy MM, Baustian C, et al.The influence of hypoxia on the differentiation capacities and immunosup-pressive properties of clonal mouse mesenchymal stromal cell lines[J]. Immunol Cell Biol, 2014, 92(7):612-623. |
| [38] | Lee JS, Park JC, Kim TW, et al.Human bone marrow stem cells cultured under hypoxic conditions present altered cha-racteristics and enhanced in vivo tissue regeneration[J]. Bone, 2015, 78:34-45. |
| [39] | Grayson WL, Zhao F, Bunnell B, et al.Hypoxia enhances proliferation and tissue formation of human mesenchymal stem cells[J]. Biochem Biophys Res Commun, 2007, 358(3):948-953. |
| [40] | Lin D, Zhou L, Wang B, et al.Overexpression of HIF-1α in mesenchymal stem cells contributes to repairing hypoxic-ischemic brain damage in rats[J]. C R Biol, 2017, 340(1):18-24. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
This work is licensed under a Creative Commons Attribution 3.0 License.