In vitro osteogenic performance study of graphene oxide-coated titanium surfaces modified with dopamine or silane

doi:10.7518/hxkq.2025.2024357

Abstract

Abstract:

Objective This study aimed to compare the osteogenic performance differences of titanium surface coatings modified by dopamine or silanized graphene oxide, and to provide a more suitable modification scheme for titanium surface graphene oxide coatings. Methods Titanium was subjected to alkali-heat treatment and then modified with dopamine and silanization, respectively, followed by coating with graphene oxide. Control and experimental groups were designed as follows: pure titanium (Ti) group; titanium after alkali-heat treatment (Ti-NaOH) group; titanium after alkali-heat treatment and silanization modification (Ti-APTES) group; titanium after alkali-heat treatment and dopamine modification (Ti-DOPA) group; titanium with silanization-modified surface decorated with graphene oxide (Ti-APTES/GO) group; titanium with dopamine-modified surface decorated with graphene oxide (Ti-DOPA/GO) group. The physical and chemical properties of the material surfaces were analyzed using scanning electron microscopy (SEM), contact angle goniometer, X-ray photoelectron spectroscopy (XPS), and Raman spectrometer. The proliferation and adhesion morphology of mouse embryonic osteoblast precursor cells MC3T3-E1 on the material surfaces were observed by cell viability detection and immunofluorescence staining followed by laser confocal microscopy. The effects on the osteogenic differentiation of MC3T3-E1 cells were studied by alkaline phosphatase (ALP) staining, alizarin red staining and quantification, and real-time quantitative polymerase chain reaction. Results After modification with graphene oxide coating, a thin-film-like structure was observed on the surface under SEM. The hydrophilicity of all experimental groups was improved, among which the Ti-DOPA/GO group had the best hydrophilicity. XPS and Raman spectroscopy analysis showed that the modified materials exhibited typical D and G peaks, and XPS revealed the presence of a large number of oxygen-containing functional groups on the surface. CCK8 assay showed that all groups of materials had no cytotoxicity, and the proliferation level of the Ti-APTES/GO group was higher than that of the Ti-DOPA/GO group. Under the laser confocal microscope, the cells in the Ti-DOPA/GO and Ti-APTES/GO groups spread more fully. The Ti-DOPA/GO and Ti-APTES/GO groups had the deepest ALP staining, and the Ti-APTES/GO group had the most alizarin red-stained mineralized nodules and the highest quantitative result of alizarin red staining. In the Ti-DOPA/GO and Ti-APTES/GO groups, the expression of the early osteogenic-related gene RUNX2 reached a relatively high level, while in the expression of the late osteogenic-related genes OPN and OCN, the Ti-APTES/GO group performed better than the Ti-DOPA/GO group. Conclusion Ti-APTES/GO significantly outperformed Ti-DOPA/GO in promoting the adhesion, proliferation, and in vitro osteogenic differentiation of MC3T3-E1 cells

Key words: titanium, graphene oxide, surface modification, osteogenic differentiation

CLC Number:

R782

Wu Qinglin, Lai Yingzhen, Huang Yanling, Xie Zeyu, Lin Yanyin. In vitro osteogenic performance study of graphene oxide-coated titanium surfaces modified with dopamine or silane[J]. West China Journal of Stomatology, 2025, 43(3): 336-345.

Figures/Tables 8

Tab 1

Fig 1

Fig 2

Fig 3

Fig 4

Fig 5

Fig 6

Fig 7

References 43

1	Brånemark PI, Adell R, Breine U, et al. Intra-osseous anchorage of dental prostheses. I. Experimental studies[J]. Scand J Plast Reconstr Surg, 1969, 3(2): 81-100.
2	Xu JY, Zhang JW, Shi YF, et al. Surface modification of biomedical Ti and Ti alloys: a review on current advances[J]. Materials (Basel), 2022, 15(5): 1749.
3	杨帮成, 周学东, 于海洋, 等. 钛种植体表面改性方法[J]. 华西口腔医学杂志, 2019, 37(2): 124-129.
	Yang BC, Zhou XD, Yu HY, et al. Advances in titanium dental implant surface modification[J]. West China J Stomatol, 2019, 37(2): 124-129.
4	Spriano S, Yamaguchi S, Baino F, et al. A critical review of multifunctional titanium surfaces: new frontiers for improving osseointegration and host response, avoiding bacteria contamination[J]. Acta Biomater, 2018, 79: 1-22.
5	Xiao X, Xu Y, Fu JJ, et al. Enhanced hydroxyapatite growth and osteogenic activity on polydopamine coated Ti implants[J]. Nanosci Nanotechnol Lett, 2015, 7(3): 233-239.
6	Pan HT, Zheng QX, Guo XD, et al. Polydopamine-assisted BMP-2-derived peptides immobilization on biomimetic copolymer scaffold for enhanced bone induction in vitro and in vivo [J]. Colloids Surf B Biointerfaces, 2016, 142: 1-9.
7	Cui DP, Guo W, Chang J, et al. Polydopamine-coated polycaprolactone/carbon nanotube fibrous scaffolds loa-ded with basic fibroblast growth factor for wound hea-ling[J]. Mater Today Bio, 2024, 28: 101190.
8	Zhao L, Zhang MY, Guo YF, et al. Alendronate-modified polydopamine-coated paclitaxel nanoparticles for osteosarcoma-targeted therapy[J]. J Drug Deliv Sci Technol, 2019, 53: 101133.
9	Yan M, Liang W, Du L, et al. Metronidazole-loaded polydopamine nanomedicine with antioxidant and antibacterial bioactivity for periodontitis[J]. Nanomedicine (Lond), 2023, 18(29): 2143-2157.
10	Daneshmandi L, Barajaa M, Tahmasbi Rad A, et al. Graphene-based biomaterials for bone regenerative enginee-ring: a comprehensive review of the field and considerations regarding biocompatibility and biodegradation[J]. Adv Healthc Mater, 2021, 10(1): e2001414.
11	Moore L, Gatica M, Kim H, et al. Multi-protein delivery by nanodiamonds promotes bone formation[J]. J Dent Res, 2013, 92(11): 976-981.
12	Hao LJ, Li TJ, Wang L, et al. Mechanistic insights into the adsorption and bioactivity of fibronectin on surfaces with varying chemistries by a combination of experimental strategies and molecular simulations[J]. Bioact Mater, 2021, 6(10): 3125-3135.
13	Schünemann FH, Galárraga-Vinueza ME, Magini R, et al. Zirconia surface modifications for implant dentistry[J]. Mater Sci Eng C Mater Biol Appl, 2019, 98: 1294-1305.
14	Shin RS, Li Y, Jang LH, et al. Graphene-based materials for tissue engineering[J]. Adv Drug Deliv Rev, 2016, 105(PB): 255-274.
15	Hermenean A, Codreanu A, Herman H, et al. Chitosan-graphene oxide 3D scaffolds as promising tools for bone regeneration in critical-size mouse calvarial defects[J]. Sci Rep, 2017, 7(1): 16641.
16	Xu K, Tang X, Xiang Y, et al. Impact of high sodium diet on neovascularization and osseointegration around titanium implant: an in vivo and in vivo study[J]. Bio-med Environ Sci, 2024, 37(7): 739-753.
17	He XH, Guo CQ, Wang YH, et al. Enhancing osseointegration of titanium implants through MC3T3-E1 protein-gelatin polyelectrolyte multilayers[J]. J Biomed Mater Res B Appl Biomater, 2024, 112(2): e35373.
18	Albrektsson T, Brånemark PI, Hansson HA, et al. Osseointegrated titanium implants. Requirements for ensuring a long-lasting, direct bone-to-implant anchorage in man[J]. Acta Orthop Scand, 1981, 52(2): 155-170.
19	Kaur M, Singh K. Review on titanium and titanium based alloys as biomaterials for orthopaedic applications[J]. Mater Sci Eng C, 2019, 102: 844-862.
20	Han X, Ma JX, Tian AX, et al. Surface modification te-chniques of titanium and titanium alloys for biomedical orthopaedics applications: a review[J]. Colloids Surf B Biointerfaces, 2023, 227: 113339.
21	Li X, Wang L, Fan Y, et al. Nanostructured scaffolds for bone tissue engineering[J]. J Biomed Mater Res A, 2013, 101(8): 2424-2435.
22	Sjöström T, Brydone AS, Meek RM, et al. Titanium nanofeaturing for enhanced bioactivity of implanted orthopedic and dental devices[J]. Nanomedicine (Lond), 2013, 8(1): 89-104.
23	Chen X, Zhu RF, Gao H, et al. A microstructural study on the alkali-treated titanium subjected to induction hea-ting[J]. J Mater Res Technol, 2022, 20: 281-290.
24	Gao H, Jie YF, Wang ZQ, et al. Bioactive tantalum metal prepared by micro-arc oxidation and NaOH treatment[J]. J Mater Chem B, 2014, 2(9): 1216-1224.
25	Gailite L, Scopelliti PE, Sharma VK, et al. Nanoscale roughness affects the activity of enzymes adsorbed on cluster-assembled titania films[J]. Langmuir, 2014, 30(20): 5973-5981.
26	Zhao G, Schwartz Z, Wieland M, et al. High surface energy enhances cell response to titanium substrate microstructure[J]. J Biomed Mater Res A, 2005, 74(1): 49-58.
27	Cheng W, Zeng XW, Chen HZ, et al. Versatile polydopamine platforms: synthesis and promising applications for surface modification and advanced nanomedicine[J]. A-CS Nano, 2019, 13(8): 8537-8565.
28	Guo Q, Chen JS, Wang JL, et al. Recent progress in synthesis and application of mussel-inspired adhesives[J]. Nanoscale, 2020, 12(3): 1307-1324.
29	Yang HL, Xu YZ, Zhu M, et al. Inhibition of titanium-particle-induced inflammatory osteolysis after local administration of dopamine and suppression of osteoclastogenesis via D2-like receptor signaling pathway[J]. Biomaterials, 2016, 80: 1-10.
30	Hanami K, Nakano K, Saito K, et al. Dopamine D2-like receptor signaling suppresses human osteoclastogenesis[J]. Bone, 2013, 56(1): 1-8.
31	Wang C, Chen X, Knierim JJ. Egocentric and allocentric representations of space in the rodent brain[J]. Curr O-pin Neurobiol, 2020, 60: 12-20.
32	Wu MH, Chen FX, Liu HF, et al. Bioinspired sandwich-like hybrid surface functionalized scaffold capable of regulating osteogenesis, angiogenesis, and osteoclastogenesis for robust bone regeneration[J]. Mater Today Bio, 2022, 17: 100458.
33	Su JH, Du ZB, Xiao L, et al. Graphene oxide coated titanium surfaces with osteoimmunomodulatory role to enhance osteogenesis[J]. Mater Sci Eng C Mater Biol Appl, 2020, 113: 110983.
34	Dettin M, Herath T, Gambaretto R, et al. Assessment of novel chemical strategies for covalent attachment of adhesive peptides to rough titanium surfaces: XPS analysis and biological evaluation[J]. J Biomed Mater Res A, 2009, 91(2): 463-479.
35	Yu X, Xu R, Zhang Z, et al. Different cell and tissue behavior of micro-/ nano-tubes and micro-/ nano-nets topographies on selective laser melting titanium to enhan-ce osseointegration[J]. Int J Nanomedicine, 2021, 16: 3329-3342.
36	Senna PM, de Almeida Barros Mourão CF, Mello-Ma-chado RC, et al. Silane-coating strategy for titanium functionalization does not impair osteogenesis in vivo [J]. Materials (Basel), 2021, 14(7): 1814.
37	Wang H, Lai YZ, Xie ZY, et al. Graphene oxide-modified concentric microgrooved titanium surfaces for the dual effects of osteogenesis and antiosteoclastogenesis[J]. ACS Appl Mater Interfaces, 2022, 14(49): 54500-54516.
38	Seok JM, Choe G, Lee SJ, et al. Enhanced three-dimensional printing scaffold for osteogenesis using a mussel-inspired graphene oxide coating[J]. Mater Des, 2021, 209: 109941.
39	Li Q, Wang Z. Involvement of FAK/P38 signaling pathways in mediating the enhanced osteogenesis induced by nano-graphene oxide modification on titanium implant surface[J]. Int J Nanomedicine, 2020, 15: 4659-4676.
40	Ren LP, Pan S, Li HQ, et al. Effects of aspirin-loaded graphene oxide coating of a titanium surface on proliferation and osteogenic differentiation of MC3T3-E1 cells[J]. Sci Rep, 2018, 8(1): 15143.
41	Zheng D, Neoh KG, Shi ZL, et al. Assessment of stability of surface anchors for antibacterial coatings and immobilized growth factors on titanium[J]. J Colloid Interface Sci, 2013, 406: 238-246.
42	Ou JF, Wang JQ, Liu S, et al. Tribology study of redu-ced graphene oxide sheets on silicon substrate synthesi-zed via covalent assembly[J]. Langmuir, 2010, 26(20): 15830-15836.
43	Felgueiras HP, Evans MDM, Migonney V. Contribution of fibronectin and vitronectin to the adhesion and morphology of MC3T3-E1 osteoblastic cells to poly(NaSS) grafted Ti₆Al₄V[J]. Acta Biomater, 2015, 28: 225-233.

基因	引物序列（5'-3'）
RUNX2	AACGATCTGAGATTTGTGGGC CCTGCGTGGGATTTCTTGGTT
ALP	CCAACTCTTTTGTGCCAGAGA GGCTACATTGGTGTTGAGCTTTT
COL-I	GCTCCTCTTAGGGGCCACT CCACGTCTCACCATTGGGG
OCN	CTGACCTCACAGATCCCAAGC TGGTCTGATAGCTCGTCACAAG
OPN	AGCAAGAAACTCTTCCAAGCAA GTGAGATTCGTCAGATTCATCCG
Osterix	ACCCCAAGATGTCTATAAGCCC CGCTCTAGCTCCTGACAGTTG
GAPDH	ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC

[1]	Zhang Xueying, Meng Xin, Liu Zhizhen, Zhang Kang, Ji Honghai, Sun Minmin. Ginsenoside Rb3 regulates the phosphorrylated extracellular signal-regulated kinase signaling pathway to alleviate inflammatory responses and promote osteogenesis in rats with periodontitis [J]. West China Journal of Stomatology, 2025, 43(2): 236-248.
[2]	Cui Chen, Quan Jingjing, Wei Xi. Research progress in problem-solving nickel-titanium rotary instrument in endodontics [J]. West China Journal of Stomatology, 2024, 42(6): 699-705.
[3]	Dong Danni, Huang Yanling, Lai Yingzhen, Yin Ge. Effects of collagen modification on the osteogenic performance of different surface-modified titanium samples in vitro [J]. West China Journal of Stomatology, 2024, 42(4): 452-461.
[4]	Hu Jing, Cui Zhihua, Huang Keqiang, Su Rongjian, Zhao Song. Role of the GRP78-c-Src signaling pathway on osteoblast differentiation of periodontal ligament fibroblasts induced by cyclic mechanical stretch [J]. West China Journal of Stomatology, 2024, 42(3): 304-312.
[5]	Sun Yanping, Liao Li. Effects of surface nanomorphology on the senescence of periodontal ligament stem cells [J]. West China Journal of Stomatology, 2024, 42(2): 172-180.
[6]	Tang Xiaoxue, Zhou Zheng, Li Qiqi, Jiang Dandan. Effects of sitagliptin activation of the stromal cell-derived factor-1/CXC chemokine receptor 4 signaling pathway on the proliferation, apoptosis, inflammation, and osteogenic differentiation of human periodontal ligament stem cells induced by lipopolysaccharide [J]. West China Journal of Stomatology, 2024, 42(1): 37-45.
[7]	Wang Hong, Wu Qinglin, Lai Yingzhen, Cai Yihuang.. Effect of graphene-oxide-modified osteon-like concentric microgrooved surface on the osteoclastic differentiation of macrophages [J]. West China Journal of Stomatology, 2023, 41(2): 165-174.
[8]	Zhang Min, Ao Xiaogang, Zheng Zheng, Chen Wenchuan.. Promoting the adhesion of human gingival epithelial cells on titanium surface by non-thermal atmospheric plasma irradiation [J]. West China Journal of Stomatology, 2022, 40(3): 285-292.
[9]	Zhang Peng, Zuo Dongchuan, Mou Siyu, Zhong Yutong, Yuan Xiaoping, Zeng Jin. Effect of inward rectifier potassium 2.1 channel on the osteogenic differentiation of human dental follicle cells and its mechanism [J]. West China Journal of Stomatology, 2022, 40(2): 139-147.
[10]	Pang Ming, Wei Hongxia, Chen Xi. Long non-coding RNA potassium voltage-gated channel subfamily Q member 1 overlapping transcript 1 regulates the proliferation and osteogenic differentiation of human periodontal ligament stem cells by targeting miR-24-3p [J]. West China Journal of Stomatology, 2021, 39(5): 547-554.
[11]	Ao Xiaogang, Chen Wenchuan. Research progress on the osseointegration of titanium implants promoted by cold atmospheric plasma [J]. West China Journal of Stomatology, 2020, 38(5): 566-570.
[12]	Wen Jiahui, Wu Yanmin, Chen Lili. Functions of non-coding RNAs in the osteogenic differentiation of human periodontal ligament-derived cells [J]. West China Journal of Stomatology, 2020, 38(3): 330-337.
[13]	Lin Yongsheng,Wang Fengzhi,Lei Xiaojing,He Jianmin. Comparative study with the effect of stromal cell derived factor-1 on osteogenic differentiation of human healthy and inflammatory periodontal ligament stem cells [J]. West China Journal of Stomatology, 2019, 37(5): 469-475.
[14]	Yue Wu,Jianfeng Jin. Surface characteristics of pure titanium loaded graphene oxide: effect on bacteria adhesion and osteoblast structure [J]. West China Journal of Stomatology, 2019, 37(4): 366-371.
[15]	Jiehang Li,Zhifei Su,Xuan Bai,He Yuan,Jiyao Li. Effect of zoladronate on the proliferation and osteogenic differentiation of rat bone mesenchymal stem cells [J]. West China Journal of Stomatology, 2019, 37(3): 242-247.