Characterization of microRNAs profiles of induced pluripotent stem cells reprogrammed from human dental pulp stem cells and stem cells from apical papilla

doi:10.7518/hxkq.2017.03.008

Abstract

Abstract:

Objective To compare characterization of microRNAs (miRNAs) expression profiles of induced pluripotent stem cells (iPSCs) reprogrammed from human dental pulp stem cells (DPSCs) and stem cells from apical papilla (SCAP) and screen-specific microRNA. Methods Human DPSCs and SCAP were reprogrammed into iPSCs using a Sendai virus vector. Total RNA of human DPSCs-iPSCs and SCAP-iPSCs were extracted. miRNAs were labeled and hybridized. Slides were scanned, and images were imported into GenePix Pro 6.0 for grid alignment and data extraction. Significant differentially expressed miRNAs between the two groups were identified using fold change and P-value and were analyzed. Results Both human DPSCs and SCAP were successfully reprogrammed into iPSCs. Among miRNA genes analyzed by miRNA microarray, 68 were differentially expressed by more than 10-fold in DPSCs-iPSCs; 37 of these genes were up-regulated, and 31 were down-regulated. In SCAP-iPSCs, 107 genes were differentially expressed by more than 10-fold; 68 were up-regulated, and 39 were down-regulated. In both cells, only miR-302e was up-regulated, whereas 9 miRNAs were down-regulated: miR-29b-3p, miR-181b-5p, miR-4328, miR-22-5p, miR-145-5p, miR-4324, let-7b-5p, miR-181a-5p, and miR-27b-3p. Conclusion Multiple miRNAs participated in reprogramming of human DPSCs and SCAP into iPSCs. Most miRNAs are related to cell cycle, transforming growth factor-β signaling pathways and epithelial-mesenchymal transition.

Key words: induced pluripotent stem cells, dental pulp stem cells, stem cells from apical papilla, reprogramming, microRNAs

CLC Number:

R 781

Xiaobing Tan, Qingyuan Dai. Characterization of microRNAs profiles of induced pluripotent stem cells reprogrammed from human dental pulp stem cells and stem cells from apical papilla[J]. West China Journal of Stomatology, 2017, 35(3): 269-274.

Figures/Tables 6

Tab 1

Fig 1

Fig 2

Fig 3

Fig 4

Tab 2

References 26

[1]	Takahashi K, Tanabe K, Ohnuki M, et al.Induction of plu-ripotent stem cells from adult human fibroblasts by defined factors[J]. Cell, 2007, 131(5):861-872.
[2]	Yu JY, Vodyanik MA, Smuga-Otto KA, et al.Induced plu-ripotent stem cell lines derived from human somatic cells[J]. Science, 2007, 318(5858):1917-1920.
[3]	Hu K.All roads lead to induced pluripotent stem cells: the technologies of iPSC generation[J]. Stem Cells Dev, 2014, 23(12):1285-1300.
[4]	Zhao B, Yang D, Jiang J, et al.Genome-wide mapping of miRNAs expressed in embryonic stem cells and pluripotent stem cells generated by different reprogramming strategies[J]. BMC Genomics, 2014, 15(1):488.
[5]	Sharma A, Wu JC.MicroRNA expression profiling of human-induced pluripotent and embryonic stem cells[J]. Methods Mol Biol, 2013, 936:247-256.
[6]	Zou XY, Yang HY, Yu Z, et al.Establishment of transgene-free induced pluripotent stem cells reprogrammed from human stem cells of apical papilla for neural differentiation[J]. Stem Cell Res Ther, 2012, 3(5):43.
[7]	Gronthos S, Arthur A, Bartold PM, et al.A method to isolate and culture expand human dental pulp stem cells[J]. Methods Mol Biol, 2011, 698:107-121.
[8]	Lee RC, Feinbaum RL, Ambros V.The C. elegans hetero-chronic gene lin-4 encodes small RNAs with antisense com-plementarity to lin-14[J]. Cell, 1993, 75(5):843-854.
[9]	Martinez NJ, Gregory RI.MicroRNA gene regulatory path-ways in the establishment and maintenance of ESC identity[J]. Cell Stem Cell, 2010, 7(1):31-35.
[10]	Marson A, Levine SS, Cole MF, et al.Connecting microRNA genes to the core transcriptional regulatory circuitry of em-bryonic stem cells[J]. Cell, 2008, 134(3):521-533.
[11]	Card DA, Hebbar PB, Li L, et al.Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells[J]. Mol Cell Biol, 2008, 28(20):6426-6438.
[12]	Tay Y, Zhang J, Thomson AM, et al.MicroRNAs to nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation[J]. Nature, 2008, 455(7216):1124-1128.
[13]	Wellner U, Schubert J, Burk UC, et al.The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs[J]. Nat Cell Biol, 2009, 11(12):1487-1495.
[14]	Xu N, Papagiannakopoulos T, Pan GJ, et al.MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluri-potency in human embryonic stem cells[J]. Cell, 2009, 137(4):647-658.
[15]	Melton C, Judson RL, Blelloch R.Opposing microRNA families regulate self-renewal in mouse embryonic stem cells[J]. Nature, 2010, 463(7281):621-626.
[16]	Sun F, Wan M, Xu X, et al.Crosstalk between miR-34a and notch signaling promotes differentiation in apical papilla stem cells (SCAPs)[J]. J Dent Res, 2014, 93(6):589-595.
[17]	Wan M, Gao B, Sun F, et al.microRNA miR-34a regulates cytodifferentiation and targets multi-signaling pathways in human dental papilla cells[J]. PLoS One, 2012, 7(11):e50090.
[18]	Montserrat N, Ramírez-Bajo MJ, Xia Y, et al.Generation of induced pluripotent stem cells from human renal proximal tubular cells with only two transcription factors, OCT4 and SOX2[J]. J Biol Chem, 2012, 287(29):24131-24138.
[19]	Wilson KD, Venkatasubrahmanyam S, Jia F, et al.MicroRNA profiling of human-induced pluripotent stem cells[J]. Stem Cells Dev, 2009, 18(5):749-758.
[20]	Gruber AJ, Grandy WA, Balwierz PJ, et al.Embryonic stem cell-specific microRNAs contribute to pluripotency by in-hibiting regulators of multiple differentiation pathways[J]. Nucleic Acids Res, 2014, 42(14):9313-9326.
[212]	Anokye-Danso F, Trivedi CM, Juhr D, et al.Highly effi-cient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency[J]. Cell Stem Cell, 2011, 8(4):376-388.
[22]	Liao B, Bao X, Liu L, et al.MicroRNA cluster 302-367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition[J]. J Biol Chem, 2011, 286(19):17359-17364.
[23]	Li Z, Yang CS, Nakashima K, et al.Small RNA-mediated regulation of iPS cell Generation[J]. EMBO J, 2011, 30(5):823-834.
[24]	Pfaff N, Fiedler J, Holzmann A, et al.miRNA screening reveals a new miRNA family stimulating iPS cell Generation via regu-lation of Meox2[J]. EMBO Rep, 2011, 12(11):1153-1159.
[25]	Michon F, Tummers M, Kyyrönen M, et al.Tooth morpho-genesis and ameloblast differentiation are regulated by micro-RNAs[J]. Dev Biol, 2010, 340(2):355-368.
[26]	Kim EJ, Lee MJ, Li L, et al.Failure of tooth formation me-diated by miR-135a overexpression via BMP signaling[J]. J Dent Res, 2014, 93(6):571-575.

基因	引物序列（5’-3’）
Oct-4	F：GACAGGGGGAGGGGAGGAGCTAGG
	R：CTTCCCTCCAACCAGTTGCCCCAAAC
Sox2	F：GGGAAATGGGAGGGGTGCAAAAGAGG
	R：TTGCGTGAGTGTGGATGGGATTGGTG
Klf4	F：TTCCTGCATGCCAGAGGAGCCC
	R：AATGTATCGAAGGTGCTCAA
c-Myc	F：TAACTGACTAGCAGGCTTGTCG
	R：TCCACATACAGTCCTGGATGATGATG
GAPDH	F：GAAGGTGAAGGTCGGAGT
	R：GAAGATGGTGATGGGATTTC

miRNAs	上、下调倍数
miRNAs	DPSCs	SCAP
miR-302e	28.12	16.51
miR-29b-3p	-472.93	-15.82
miR-181b-5p	-233.31	-15.72
miR-4328	-29.27	-156.95
miR-22-5p	-22.45	-14.80
miR-145-5p	-19.02	-49.57
miR-4324	-18.218	-63.90
let-7b-5p	-17.62	-48.63
miR-181a-5p	-12.32	-32.64
miR-27b-3p	-10.03	-36.72