West China Journal of Stomatology ›› 2025, Vol. 43 ›› Issue (5): 711-721.doi: 10.7518/hxkq.2025.2024448
Previous Articles Next Articles
Li Hua1(
), Zhang Kang1, Qu Huijuan2, Ji Honghai1,2(
), Sun Minmin1,2(
)
Received:2024-12-10
Revised:2025-06-08
Online:2025-10-01
Published:2025-10-21
Contact:
Ji Honghai,Sun Minmin
E-mail:lihua199805@163.com;sdwf_ji@163.com;sunminmin@sdsmu.edu.cn
Supported by:CLC Number:
Li Hua, Zhang Kang, Qu Huijuan, Ji Honghai, Sun Minmin. Effect of ginsenoside Rb3 on experimental periodontitis in rats[J]. West China Journal of Stomatology, 2025, 43(5): 711-721.
Add to citation manager EndNote|Ris|BibTeX
Tab 1
Primer sequences of rats used for qPCR in this experiment
| 引物 | 序列(5’-3’) | 扩增长度/bp |
|---|---|---|
| GAPDH | F:GACATGCCGCCTGGAGAAAC | 92 |
| R:AGCCCAGGATGCCCTTTAGT | ||
| IL-6 | F:ACTTCCAGCCAGTTGCCTTCTTG | 110 |
| R:TGGTCTGTTGTGGGTGGTATCCTC | ||
| IL-1β | F:AATCTCACAGCAGCATCTCGACAAG | 98 |
| R:TCCACGGGCAAGACATAGGTAGC | ||
| CTSK | F:TGGCTGTGGAGGCGGCTATATG | 82 |
| R:CGGGTAAGCGTCTTCAGAGTCAATG | ||
| ACP5 | F:ATGACGCCAATGACAAGAGGTTCC | 125 |
| R:TTGTGCCGAGACATTGCCAAGG | ||
| NFATc1 | F:TCCCTGCCTGCCCTTGACTG | 92 |
| R:TGAGCCCTGTGGTGAGACTTGG | ||
| MMP-9 | F:CTCCTGGTGCTCCTGGCTCTAG | 112 |
| R:GCTGTGTGTCCGTGAGGTTGG |
| [1] | Yang B, Pang X, Li Z, et al. Immunomodulation in the treatment of periodontitis: progress and perspectives[J]. Front Immunol, 2021, 12: 781378. |
| [2] | Yang X, Liu P, Fan X, et al. Distribution and influencing factors on residual pockets of the teeth in patients with periodontitis following non-surgical periodontal treatment: a retrospective observational study[J]. BMC Oral Health, 2023, 23(1): 736. |
| [3] | Frencken JE, Sharma P, Stenhouse L, et al. Global epidemiology of dental caries and severe periodontitis-a comprehensive review[J]. J Clin Periodontol, 2017, 44 : S94-S105. |
| [4] | Sanz M, Marco Del Castillo A, Jepsen S, et al. Periodontitis and cardiovascular diseases: consensus report[J]. J Clin Periodontol, 2020, 47(3): 268-288. |
| [5] | Hajishengallis G. Interconnection of periodontal disease and comorbidities: evidence, mechanisms, and implications[J]. Periodontol 2000, 2022, 89(1): 9-18. |
| [6] | Darveau RP. Periodontitis: a polymicrobial disruption of host homeostasis[J]. Nat Rev Microbiol, 2010, 8(7): 481-490. |
| [7] | Ren J, Fok MR, Zhang Y, et al. The role of non-steroidal anti-inflammatory drugs as adjuncts to periodontal treatment and in periodontal regeneration[J]. J Transl Med, 2023, 21(1): 149. |
| [8] | Pan W, Wang Q, Chen Q. The cytokine network invol-ved in the host immune response to periodontitis[J]. Int J Oral Sci, 2019, 11(3): 30. |
| [9] | Zeng XZ, Zhang YY, Yang Q, et al. Artesunate attenua-tes LPS-induced osteoclastogenesis by suppressing TLR-4/TRAF6 and PLCγ1-Ca2+-NFATc1 signaling pathway[J]. Acta Pharmacol Sin, 2020, 41(2): 229-236. |
| [10] | Sun M, Ji Y, Zhou S, et al. Ginsenoside Rb3 inhibits osteoclastogenesis via ERK/NF-κB signaling pathway in vitro and in vivo [J]. Oral Dis, 2023, 29(8): 3460-3471. |
| [11] | Abdulkareem A, Abdulbaqi H, Gul S, et al. Classic vs. Novel antibacterial approaches for eradicating dental biofilm as adjunct to periodontal debridement: an evidence-based overview[J]. Antibiotics (Basel), 2021, 11(1): 9. |
| [12] | Sanz M, Herrera D, Kebschull M, et al. Treatment of stage Ⅰ-Ⅲ periodontitis-The EFP S3 level clinical practice guideline[J]. J Clin Periodontol, 2020, 47 : 4-60. |
| [13] | Herrera D, Matesanz P, Martín C, et al. Adjunctive effect of locally delivered antimicrobials in periodontitis therapy: a systematic review and meta-analysis[J]. J Clin Periodontol, 2020, 47 : 239-256. |
| [14] | Attia MS, Alblowi JA. Effect of subantimicrobial dose doxycycline treatment on gingival crevicular fluid levels of MMP-9 and MMP-13 in periodontitis stage 2, grade B in subjects with type 2 diabetes mellitus[J]. J Immunol Res, 2020, 2020: 2807259. |
| [15] | Aras H, Cağlayan F, Güncü GN, et al. Effect of systemically administered naproxen sodium on clinical parameters and myeloperoxidase and elastase-like activity levels in gingival crevicular fluid[J]. J Periodontol, 2007, 78(5): 868-873. |
| [16] | Preshaw PM, Hefti AF, Jepsen S, et al. Subantimicrobial dose doxycycline as adjunctive treatment for periodontitis. A review[J]. J Clin Periodontol, 2004, 31(9): 697-707. |
| [17] | Tonetti MS, Lang NP, Cortellini P, et al. Effects of a single topical doxycycline administration adjunctive to mechanical debridement in patients with persistent/recurrent periodontitis but acceptable oral hygiene during supportive periodontal therapy[J]. J Clin Periodontol, 2012, 39(5): 475-482. |
| [18] | Gürkan A, Cinarcik S, Hüseyinov A. Adjunctive subantimicrobial dose doxycycline: effect on clinical parameters and gingival crevicular fluid transforming growth factor-beta levels in severe, generalized chronic perio-dontitis[J]. J Clin Periodontol, 2005, 32(3): 244-253. |
| [19] | Wang Y, Dong J, Liu P, et al. Ginsenoside Rb3 attenua-tes oxidative stress and preserves endothelial function in renal arteries from hypertensive rats[J]. Br J Pharmacol, 2014, 171(13): 3171-3181. |
| [20] | Ma CH, Chou WC, Wu CH, et al. Ginsenoside Rg3 attenuates TNF-alpha-induced damage in chondrocytes through regulating SIRT1-mediated anti-apoptotic and anti-inflammatory mechanisms[J]. Antioxidants (Basel), 2021, 10(12): 1972. |
| [21] | Oh H, Cho W, Park SY, et al. Ginsenoside Rb3 ameliorates podocyte injury under hyperlipidemic conditions via PPARδ- or SIRT6-mediated suppression of inflammation and oxidative stress[J]. J Ginseng Res, 2023, 47(3): 400-407. |
| [22] | Sun M, Ji Y, Li Z, et al. Ginsenoside Rb3 inhibits pro-inflammatory cytokines via MAPK/AKT/NF-κB pathways and attenuates rat alveolar bone resorption in response to Porphyromonas gingivalis LPS[J]. Molecules, 2020, 25(20): 4815. |
| [23] | Buduneli E, Vardar S, Buduneli N, et al. Effects of combined systemic administration of low-dose doxycycline and alendronate on endotoxin-induced periodontitis in rats[J]. J Periodontol, 2004, 75(11): 1516-1523. |
| [24] | Sun J, Yu X, Huangpu H, et al. Ginsenoside Rb3 protects cardiomyocytes against hypoxia/reoxygenation injury via activating the antioxidation signaling pathway of PERK/Nrf2/HMOX1[J]. Biomed Pharmacother, 2019, 109: 254-261. |
| [25] | Ma L, Liu H, Xie Z, et al. Ginsenoside Rb3 protects cardiomyocytes against ischemia-reperfusion injury via the inhibition of JNK-mediated NF-κB pathway: a mou-se cardiomyocyte model[J]. PLoS One, 2014, 9(8): e-103628. |
| [26] | de Molon RS, Park CH, Jin Q, et al. Characterization of ligature-induced experimental periodontitis[J]. Microsc Res Tech, 2018, 81(12): 1412-1421. |
| [27] | Chen MH, Wang YH, Sun BJ, et al. HIF-1α activator DMOG inhibits alveolar bone resorption in murine periodontitis by regulating macrophage polarization[J]. Int Immunopharmacol, 2021, 99: 107901. |
| [28] | Castro ML, Franco GC, Branco-De-Almeida LS, et al. Downregulation of proteinase-activated receptor-2, interleukin-17, and other proinflammatory genes by subantimicrobial doxycycline dose in a rat periodontitis model[J]. J Periodontol, 2016, 87(2): 203-210. |
| [29] | Hamidzadeh K, Christensen SM, Dalby E, et al. Macrophages and the recovery from acute and chronic inflammation[J]. Annu Rev Physiol, 2017, 79: 567-592. |
| [30] | Wu L, Luo Z, Liu Y, et al. Aspirin inhibits RANKL-induced osteoclast differentiation in dendritic cells by suppressing NF-κB and NFATc1 activation[J]. Stem Cell Res Ther, 2019, 10(1): 375. |
| [31] | Mikuls TR, Payne JB, Reinhardt RA, et al. Antibody responses to Porphyromonas gingivalis (P. gingivalis) in subjects with rheumatoid arthritis and periodontitis[J]. Int Immunopharmacol, 2009, 9(1): 38-42. |
| [32] | Isola G, Polizzi A, Patini R, et al. Association among serum and salivary A. actinomycetemcomitans specific immunoglobulin antibodies and periodontitis[J]. BMC Oral Health, 2020, 20(1): 283. |
| [33] | Damgaard C, Reinholdt J, Enevold C, et al. Immunoglobulin G antibodies against Porphyromonas gingiva-lis or Aggregatibacter actinomycetemcomitans in cardiovascular disease and periodontitis[J]. J Oral Microbiol, 2017, 9(1): 1374154. |
| [34] | Jeong S, Kim MB, Baek S, et al. Suppression of pro-inflammatory M1 polarization of LPS-stimulated RAW 264.7 macrophage cells by fucoxanthin-rich sargassum hemiphyllum[J]. Marine Drugs, 2023, 21(10): 533. |
| [35] | Ge YT, Zhong AQ, Xu GF, et al. Resveratrol protects BV2 mouse microglial cells against LPS-induced inflammatory injury by altering the miR-146a-5p/TRAF6/NF-κB axis[J]. Immunopharmacol Immunotoxicol, 2019, 41(5): 549-557. |
| [36] | Zhou F, Mei J, Han X, et al. Kinsenoside attenuates osteoarthritis by repolarizing macrophages through inactivating NF-κB/MAPK signaling and protecting chondrocytes[J]. Acta Pharm Sin B, 2019, 9(5): 973-985. |
| [37] | Liu L, Guo H, Song A, et al. Progranulin inhibits LPS-induced macrophage M1 polarization via NF-кB and MAPK pathways[J]. BMC Immunol, 2020, 21(1): 32. |
| [38] | Wang J, Feng MJ, Zhang R, et al. C‑reactive protein/oxidized low density lipoprotein/β2‑glycoprotein i complexes induce lipid accumulation and inflammatory reaction in macrophages via p38/mitogen‑activated protein kinase and nuclear factor‑κB signaling pathways[J]. Mol Med Rep, 2016, 14(4): 3490-3498. |
| [1] | Zhang Xueying, Meng Xin, Liu Zhizhen, Zhang Kang, Ji Honghai, Sun Minmin. Ginsenoside Rb3 regulates the phosphorrylated extracellular signal-regulated kinase signaling pathway to alleviate inflammatory responses and promote osteogenesis in rats with periodontitis [J]. West China Journal of Stomatology, 2025, 43(2): 236-248. |
| [2] | Zhou Lulu, Teng Nian, Gao Tiantian, Wang Hongbin, Gao Xiang. Protective effect of carvacrol hydrogel on the alveolar bone in rats with periodontitis [J]. West China Journal of Stomatology, 2024, 42(5): 593-608. |
| [3] | Ren Bihui, Guo Shuigen, Xu Yehao, Dai Jieting, Wei Hongwu.. Clinical efficacy of simple taper retentive implants in immediate posterior dental implantation for 5-7 years [J]. West China Journal of Stomatology, 2023, 41(3): 341-349. |
| [4] | Zhang Qihang, Gong Jiaming, Yu Jiaying, Zhao Ruimin, Gou Ping, Yu Zhanhai. Clinical efficacy of extra-short implant (4 mm) placed in posterior areas: a Meta-analysis [J]. West China Journal of Stomatology, 2023, 41(1): 80-87. |
| [5] | Luo Houzhuo, Fang Shishu, Liu Qian, Dang Wei, Wang Yanli. Comparison of interleukin expression in gingival crevicular fluid between patients with invisible orthodontics treat-ment and fixed orthodontics treatment [J]. West China Journal of Stomatology, 2022, 40(3): 293-296. |
| [6] | Jiang Xiaoxian, Mao Chuanqing, Lai Yongzhen, Lu Meng, Wang Chengyong, Cai Zhiyu, Chen Weihui.. Preliminary efficacy analysis of block iliac bone grafting in patients with alveolar cleft in mixed dentition [J]. West China Journal of Stomatology, 2022, 40(3): 303-308. |
| [7] | Liu Xiang, Kang Wenyan, Shang Lingling, Ge Shaohua. Sitagliptin inhibits lipopolysaccharide-induced inflammatory response in human gingival fibroblasts by blocking nuclear factor-κB signaling pathway [J]. West China Journal of Stomatology, 2021, 39(2): 153-163. |
| [8] | Liu Yinchen. Developments of specialized pro-resolving mediators in periodontitis [J]. West China Journal of Stomatology, 2021, 39(1): 94-98. |
| [9] | Liao Min, Cheng Lei, Zhou Xuedong, Ren Biao. Research progress of Candida albicans on malignant transformation of oral mucosal diseases [J]. West China Journal of Stomatology, 2020, 38(4): 431-437. |
| [10] | Lin Yongsheng,Wang Fengzhi,Lei Xiaojing,He Jianmin. Comparative study with the effect of stromal cell derived factor-1 on osteogenic differentiation of human healthy and inflammatory periodontal ligament stem cells [J]. West China Journal of Stomatology, 2019, 37(5): 469-475. |
| [11] | Ai Jiang,Qiang Zhang,Wei Luo,Liang Li. Early changes of interproximal ridge height with alveolar ridge preservation of maxillary single anterior teeth [J]. West China Journal of Stomatology, 2019, 37(4): 394-397. |
| [12] | Longyi Mo,Xiaoyue Jia,Chengcheng Liu,Xuedong Zhou,Xin Xu. Role of autophagy in the pathogenesis of periodontitis [J]. West China Journal of Stomatology, 2019, 37(4): 422-427. |
| [13] | Yun Yang, Wuchao Wu, Yafei Wu, Lei. Zhao. Research progress on the relationship between triggering receptor expressed on myeloid cells 1 and 2 and malignant tumors [J]. West China Journal of Stomatology, 2017, 35(6): 648-653. |
| [14] | Chen Zhihong, Huang Guilin, Zhang Nini, Yi Jie, Yao Li, Zhang Lin.. Effects of aspirin on dendritic cells in the inflammatory microenvironment of rabbit buccal VX-2 squamous cell carcinoma [J]. West China Journal of Stomatology, 2016, 34(2): 178-182. |
| [15] | Xin Yuejiao, Liu Yiying, Xu Yi.. Developments of neutrophil function and the relationship between neutrophils dysfunction and periodontitis [J]. West China Journal of Stomatology, 2016, 34(2): 210-214. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
This work is licensed under a Creative Commons Attribution 3.0 License.