Effect of ginsenoside Rb3 on experimental periodontitis in rats

doi:10.7518/hxkq.2025.2024448

Abstract

Abstract:

Objective This study aimed to explore the therapeutic effect and mechanism of ginsenoside Rb3 on experimental periodontitis and bone resorption in rats. Methods Male SD rats were randomly divided into a control group, a ligation group, an Rb3 group, and a doxycycline (Dox) group for in vivo experiments. A periodontitis model was established by ligating the maxillary second molar, and samples were collected after 3 weeks of drug treatment. Micro-CT assessment of alveolar bone resorption was performed, and hematoxylin-eosin (HE) staining was used to observe pathological changes in periodontal and visceral tissues. Tartrate resistant acid phosphatase (TRAP) staining was applied to detect the formation of osteoclasts in periodontal tissues, and enzyme-linked immunosorbent assay (ELISA) was adopted to detect the serum levels of interleukin (IL)-6, IL-8, immunoglobulin (Ig)M, and IgG. Quantitative polymerase chain reaction (qPCR) was employed to detect the expression of factors related to gingival inflammation and osteoclast formation. Immunofluorescence staining was used to detect phospho-extracellular signal-regulated kinase (p-ERK) expression. In vitro experiments were conducted by pretreating RAW264.7 cells with drugs and adding lipopolysaccharides (LPS) stimulation from Porphyromonas gingivalis (P. gingivalis). IL-1β and IL-6 mRNA expression was detected by qPCR, and Western blot was used to detect the effect of Rb3 on the mitogen-activated protein kinases (MAPKs) signaling pathway. Results Compared with the control group, the ligation group showed significant periodontitis and bone resorption. Compared with the ligation group, the Rb3 group showed a decrease in alveolar bone resorption and osteoclast formation; p-ERK/ERK ratio, IL-1β, IL-6, and nuclear factor of activated T cells (NFATc1) mRNA levels and downstream gene expression in periodontal tissues; serum IL-6, IL-8, IgG, and IgM levels. Rb3 reduced IL-8 and IL-1β mRNA expression levels and p-ERK/ERK and p-p38 MAPK/p38 MAPK ratios in RAW264.7 cells induced by P. gingivalis LPS stimulation. Conclusion Rb3 inhibits inflammation and bone resorption in experimental periodontitis in rats. Compared with Dox, Rb3 has better effects in inhibiting pro-inflammatory factors and osteoclast gene expression and may exert anti-inflammatory effects by activating the MAPK signaling pathway.

Key words: ginsenoside Rb3, experimental periodontitis, inflammation, bone resorption, mitogen-activated protein kinases signaling pathway

CLC Number:

R781.4

Li Hua, Zhang Kang, Qu Huijuan, Ji Honghai, Sun Minmin. Effect of ginsenoside Rb3 on experimental periodontitis in rats[J]. West China Journal of Stomatology, 2025, 43(5): 711-721.

Figures/Tables 9

Tab 1

Tab 2

Fig 1

Fig 2

Fig 3

Fig 4

Fig 5

Fig 6

Fig 7

References 38

[1]	Yang B, Pang X, Li Z, et al. Immunomodulation in the treatment of periodontitis: progress and perspectives[J]. Front Immunol, 2021, 12: 781378.
[2]	Yang X, Liu P, Fan X, et al. Distribution and influencing factors on residual pockets of the teeth in patients with periodontitis following non-surgical periodontal treatment: a retrospective observational study[J]. BMC Oral Health, 2023, 23(1): 736.
[3]	Frencken JE, Sharma P, Stenhouse L, et al. Global epidemiology of dental caries and severe periodontitis-a comprehensive review[J]. J Clin Periodontol, 2017, 44 : S94-S105.
[4]	Sanz M, Marco Del Castillo A, Jepsen S, et al. Periodontitis and cardiovascular diseases: consensus report[J]. J Clin Periodontol, 2020, 47(3): 268-288.
[5]	Hajishengallis G. Interconnection of periodontal disease and comorbidities: evidence, mechanisms, and implications[J]. Periodontol 2000, 2022, 89(1): 9-18.
[6]	Darveau RP. Periodontitis: a polymicrobial disruption of host homeostasis[J]. Nat Rev Microbiol, 2010, 8(7): 481-490.
[7]	Ren J, Fok MR, Zhang Y, et al. The role of non-steroidal anti-inflammatory drugs as adjuncts to periodontal treatment and in periodontal regeneration[J]. J Transl Med, 2023, 21(1): 149.
[8]	Pan W, Wang Q, Chen Q. The cytokine network invol-ved in the host immune response to periodontitis[J]. Int J Oral Sci, 2019, 11(3): 30.
[9]	Zeng XZ, Zhang YY, Yang Q, et al. Artesunate attenua-tes LPS-induced osteoclastogenesis by suppressing TLR-4/TRAF6 and PLCγ1-Ca2+-NFATc1 signaling pathway[J]. Acta Pharmacol Sin, 2020, 41(2): 229-236.
[10]	Sun M, Ji Y, Zhou S, et al. Ginsenoside Rb3 inhibits osteoclastogenesis via ERK/NF-κB signaling pathway in vitro and in vivo [J]. Oral Dis, 2023, 29(8): 3460-3471.
[11]	Abdulkareem A, Abdulbaqi H, Gul S, et al. Classic vs. Novel antibacterial approaches for eradicating dental biofilm as adjunct to periodontal debridement: an evidence-based overview[J]. Antibiotics (Basel), 2021, 11(1): 9.
[12]	Sanz M, Herrera D, Kebschull M, et al. Treatment of stage Ⅰ-Ⅲ periodontitis-The EFP S3 level clinical practice guideline[J]. J Clin Periodontol, 2020, 47 : 4-60.
[13]	Herrera D, Matesanz P, Martín C, et al. Adjunctive effect of locally delivered antimicrobials in periodontitis therapy: a systematic review and meta-analysis[J]. J Clin Periodontol, 2020, 47 : 239-256.
[14]	Attia MS, Alblowi JA. Effect of subantimicrobial dose doxycycline treatment on gingival crevicular fluid levels of MMP-9 and MMP-13 in periodontitis stage 2, grade B in subjects with type 2 diabetes mellitus[J]. J Immunol Res, 2020, 2020: 2807259.
[15]	Aras H, Cağlayan F, Güncü GN, et al. Effect of systemically administered naproxen sodium on clinical parameters and myeloperoxidase and elastase-like activity levels in gingival crevicular fluid[J]. J Periodontol, 2007, 78(5): 868-873.
[16]	Preshaw PM, Hefti AF, Jepsen S, et al. Subantimicrobial dose doxycycline as adjunctive treatment for periodontitis. A review[J]. J Clin Periodontol, 2004, 31(9): 697-707.
[17]	Tonetti MS, Lang NP, Cortellini P, et al. Effects of a single topical doxycycline administration adjunctive to mechanical debridement in patients with persistent/recurrent periodontitis but acceptable oral hygiene during supportive periodontal therapy[J]. J Clin Periodontol, 2012, 39(5): 475-482.
[18]	Gürkan A, Cinarcik S, Hüseyinov A. Adjunctive subantimicrobial dose doxycycline: effect on clinical parameters and gingival crevicular fluid transforming growth factor-beta levels in severe, generalized chronic perio-dontitis[J]. J Clin Periodontol, 2005, 32(3): 244-253.
[19]	Wang Y, Dong J, Liu P, et al. Ginsenoside Rb3 attenua-tes oxidative stress and preserves endothelial function in renal arteries from hypertensive rats[J]. Br J Pharmacol, 2014, 171(13): 3171-3181.
[20]	Ma CH, Chou WC, Wu CH, et al. Ginsenoside Rg3 attenuates TNF-alpha-induced damage in chondrocytes through regulating SIRT1-mediated anti-apoptotic and anti-inflammatory mechanisms[J]. Antioxidants (Basel), 2021, 10(12): 1972.
[21]	Oh H, Cho W, Park SY, et al. Ginsenoside Rb3 ameliorates podocyte injury under hyperlipidemic conditions via PPARδ- or SIRT6-mediated suppression of inflammation and oxidative stress[J]. J Ginseng Res, 2023, 47(3): 400-407.
[22]	Sun M, Ji Y, Li Z, et al. Ginsenoside Rb3 inhibits pro-inflammatory cytokines via MAPK/AKT/NF-κB pathways and attenuates rat alveolar bone resorption in response to Porphyromonas gingivalis LPS[J]. Molecules, 2020, 25(20): 4815.
[23]	Buduneli E, Vardar S, Buduneli N, et al. Effects of combined systemic administration of low-dose doxycycline and alendronate on endotoxin-induced periodontitis in rats[J]. J Periodontol, 2004, 75(11): 1516-1523.
[24]	Sun J, Yu X, Huangpu H, et al. Ginsenoside Rb3 protects cardiomyocytes against hypoxia/reoxygenation injury via activating the antioxidation signaling pathway of PERK/Nrf2/HMOX1[J]. Biomed Pharmacother, 2019, 109: 254-261.
[25]	Ma L, Liu H, Xie Z, et al. Ginsenoside Rb3 protects cardiomyocytes against ischemia-reperfusion injury via the inhibition of JNK-mediated NF-κB pathway: a mou-se cardiomyocyte model[J]. PLoS One, 2014, 9(8): e-103628.
[26]	de Molon RS, Park CH, Jin Q, et al. Characterization of ligature-induced experimental periodontitis[J]. Microsc Res Tech, 2018, 81(12): 1412-1421.
[27]	Chen MH, Wang YH, Sun BJ, et al. HIF-1α activator DMOG inhibits alveolar bone resorption in murine periodontitis by regulating macrophage polarization[J]. Int Immunopharmacol, 2021, 99: 107901.
[28]	Castro ML, Franco GC, Branco-De-Almeida LS, et al. Downregulation of proteinase-activated receptor-2, interleukin-17, and other proinflammatory genes by subantimicrobial doxycycline dose in a rat periodontitis model[J]. J Periodontol, 2016, 87(2): 203-210.
[29]	Hamidzadeh K, Christensen SM, Dalby E, et al. Macrophages and the recovery from acute and chronic inflammation[J]. Annu Rev Physiol, 2017, 79: 567-592.
[30]	Wu L, Luo Z, Liu Y, et al. Aspirin inhibits RANKL-induced osteoclast differentiation in dendritic cells by suppressing NF-κB and NFATc1 activation[J]. Stem Cell Res Ther, 2019, 10(1): 375.
[31]	Mikuls TR, Payne JB, Reinhardt RA, et al. Antibody responses to Porphyromonas gingivalis (P. gingivalis) in subjects with rheumatoid arthritis and periodontitis[J]. Int Immunopharmacol, 2009, 9(1): 38-42.
[32]	Isola G, Polizzi A, Patini R, et al. Association among serum and salivary A. actinomycetemcomitans specific immunoglobulin antibodies and periodontitis[J]. BMC Oral Health, 2020, 20(1): 283.
[33]	Damgaard C, Reinholdt J, Enevold C, et al. Immunoglobulin G antibodies against Porphyromonas gingiva-lis or Aggregatibacter actinomycetemcomitans in cardiovascular disease and periodontitis[J]. J Oral Microbiol, 2017, 9(1): 1374154.
[34]	Jeong S, Kim MB, Baek S, et al. Suppression of pro-inflammatory M1 polarization of LPS-stimulated RAW 264.7 macrophage cells by fucoxanthin-rich sargassum hemiphyllum[J]. Marine Drugs, 2023, 21(10): 533.
[35]	Ge YT, Zhong AQ, Xu GF, et al. Resveratrol protects BV2 mouse microglial cells against LPS-induced inflammatory injury by altering the miR-146a-5p/TRAF6/NF-κB axis[J]. Immunopharmacol Immunotoxicol, 2019, 41(5): 549-557.
[36]	Zhou F, Mei J, Han X, et al. Kinsenoside attenuates osteoarthritis by repolarizing macrophages through inactivating NF-κB/MAPK signaling and protecting chondrocytes[J]. Acta Pharm Sin B, 2019, 9(5): 973-985.
[37]	Liu L, Guo H, Song A, et al. Progranulin inhibits LPS-induced macrophage M1 polarization via NF-кB and MAPK pathways[J]. BMC Immunol, 2020, 21(1): 32.
[38]	Wang J, Feng MJ, Zhang R, et al. C‑reactive protein/oxidized low density lipoprotein/β2‑glycoprotein i complexes induce lipid accumulation and inflammatory reaction in macrophages via p38/mitogen‑activated protein kinase and nuclear factor‑κB signaling pathways[J]. Mol Med Rep, 2016, 14(4): 3490-3498.

引物	序列（5’-3’）	扩增长度/bp
GAPDH	F：GACATGCCGCCTGGAGAAAC	92
	R：AGCCCAGGATGCCCTTTAGT
IL-6	F：ACTTCCAGCCAGTTGCCTTCTTG	110
	R：TGGTCTGTTGTGGGTGGTATCCTC
IL-1β	F：AATCTCACAGCAGCATCTCGACAAG	98
	R：TCCACGGGCAAGACATAGGTAGC
CTSK	F：TGGCTGTGGAGGCGGCTATATG	82
	R：CGGGTAAGCGTCTTCAGAGTCAATG
ACP5	F：ATGACGCCAATGACAAGAGGTTCC	125
	R：TTGTGCCGAGACATTGCCAAGG
NFATc1	F：TCCCTGCCTGCCCTTGACTG	92
	R：TGAGCCCTGTGGTGAGACTTGG
MMP-9	F：CTCCTGGTGCTCCTGGCTCTAG	112
	R：GCTGTGTGTCCGTGAGGTTGG

引物	序列（5’-3’）	扩增长度/bp
GAPDH	F：GGTTGTCTCCTGCGACTTCA	183
	R：TGGTCCAGGGTTTCTTACTCC
IL-8	F：GAGACTTCCATCCAGTTGCCTTC	151
	R：TGTGTAATTAAGCCTCCGACTTGTG
IL-1β	F：TCGCAGCAGCACATCAACAAG	190
	R：CCAGCAGGTTATCATCATCATCCC