West China Journal of Stomatology ›› 2021, Vol. 39 ›› Issue (2): 153-163.doi: 10.7518/hxkq.2021.02.005
Previous Articles Next Articles
Liu Xiang(), Kang Wenyan, Shang Lingling, Ge Shaohua()
Received:
2020-07-19
Revised:
2020-11-27
Online:
2021-04-01
Published:
2021-04-09
Contact:
Ge Shaohua
E-mail:492998461@qq.com;shaohuage@sdu.edu.cn
Supported by:
CLC Number:
Liu Xiang, Kang Wenyan, Shang Lingling, Ge Shaohua. Sitagliptin inhibits lipopolysaccharide-induced inflammatory response in human gingival fibroblasts by blocking nuclear factor-κB signaling pathway[J]. West China Journal of Stomatology, 2021, 39(2): 153-163.
Add to citation manager EndNote|Ris|BibTeX
Tab 1
Primer sequences for qRT-PCR
引物 | 序列(5’-3’) |
---|---|
GAPDH | 上游:ACCACAGTCCATGCCATCAC 下游:ACCACCCTGTTGCTGTA |
IL-6 | 上游:ATAACCACCCCTGACCCAAC 下游:CCCATGCTACATTTGCCGAA |
IL-8 | 上游:TCAGAGACAGCAGAGCACAC 下游:GGCAAAACTGCACCTTCACA |
CCL2 | 上游:CAGCCAGATGCAATCAATGCC 下游:TGGAATCCTGAACCCACTTCT |
SOD2 | 上游:GGGATTGATGTGTGGGAGCA 下游:CATAAAGAGCTTAACATACTCAGCA |
1 | Ji S, Choi YS, Choi Y. Bacterial invasion and persistence: critical events in the pathogenesis of periodontitis[J]. J Periodontal Res, 2015, 50(5): 570-585. |
2 | Chapple IL, Matthews JB. The role of reactive oxygen and antioxidant species in periodontal tissue destruction[J]. Periodontol 2000, 2007, 43: 160-232. |
3 | Meyle J, Chapple I. Molecular aspects of the pathogenesis of periodontitis[J]. Periodontol 2000, 2015, 69(1): 7-17. |
4 | Laine ML, Crielaard W, Loos BG. Genetic susceptibility to periodontitis[J]. Periodontol 2000, 2012, 58(1): 37-68. |
5 | Bostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen[J]. FEMS Microbiol Lett, 2012, 333(1): 1-9. |
6 | Gölz L, Memmert S, Rath-Deschner B, et al. LPS from P. gingivalis and hypoxia increases oxidative stress in periodontal ligament fibroblasts and contributes to periodontitis[J]. Mediators Inflamm, 2014, 2014: 986264. |
7 | Kinane DF. Causation and pathogenesis of periodontal disease[J]. Periodontol 2000, 2001, 25: 8-20. |
8 | Wang PL, Azuma Y, Shinohara M, et al. Toll-like receptor 4-mediated signal pathway induced by Porphyromonas gingivalis lipopolysaccharide in human gingival fibroblasts[J]. Biochem Biophys Res Commun, 2000, 273(3): 1161-1167. |
9 | Trindade F, Oppenheim FG, Helmerhorst EJ, et al. Uncovering the molecular networks in periodontitis[J]. Proteomics Clin Appl, 2014, 8(9/10): 748-761. |
10 | Buckley CD, Pilling D, Lord JM, et al. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation[J]. Trends Immunol, 2001, 22(4): 199-204. |
11 | Ara T, Kurata K, Hirai K, et al. Human gingival fibroblasts are critical in sustaining inflammation in periodontal disease[J]. J Periodontal Res, 2009, 44(1): 21-27. |
12 | Buckley CD. Why does chronic inflammation persist: an unexpected role for fibroblasts[J]. Immunol Lett, 2011, 138(1): 12-14. |
13 | Wang Q, Zhang B, Yu JL. Farrerol inhibits IL-6 and IL-8 production in LPS-stimulated human gingival fibroblasts by suppressing PI3K/AKT/NF-κB signaling pathway[J]. Arch Oral Biol, 2016, 62: 28-32. |
14 | Damgaard C, Kantarci A, Holmstrup P, et al. Porphyromonas gingivalis-induced production of reactive oxygen species, tumor necrosis factor-α, interleukin-6, CXCL8 and CCL2 by neutrophils from localized aggressive periodontitis and healthy donors: modulating actions of red blood cells and resolvin E1[J]. J Periodontal Res, 2017, 52(2): 246-254. |
15 | Yoon Y, Kim TJ, Lee JM, et al. SOD2 is upregulated in periodontitis to reduce further inflammation progression[J]. Oral Dis, 2018, 24(8): 1572-1580. |
16 | Zerilli T, Pyon EY. Sitagliptin phosphate: a DPP-4 inhibitor for the treatment of type 2 diabetes mellitus[J]. Clin Ther, 2007, 29(12): 2614-2634. |
17 | Satoh-Asahara N, Sasaki Y, Wada H, et al. A dipeptidyl peptidase-4 inhibitor, sitagliptin, exerts anti-inflammatory effects in type 2 diabetic patients[J]. Metabolism, 2013, 62(3): 347-351. |
18 | Jiang W, Wen D, Cheng Z, et al. Effect of sitagliptin, a DPP-4 inhibitor, against DENA-induced liver cancer in rats mediated via NF-κB activation and inflammatory cytokines[J]. J Biochem Mol Toxicol, 2018, 32(12): e22220. |
19 | Vaghasiya J, Sheth N, Bhalodia Y, et al. Sitagliptin protects renal ischemia reperfusion induced renal damage in diabetes[J]. Regul Pept, 2011, 166(1/2/3): 48-54. |
20 | Omoto S, Taniura T, Nishizawa T, et al. Anti-atherosclerotic effects of sitagliptin in patients with type 2 diabetes mellitus[J]. Diabetes Metab Syndr Obes, 2015, 8: 339-345. |
21 | Huang CY, Shih CM, Tsao NW, et al. Dipeptidyl peptidase-4 inhibitor improves neovascularization by increasing circulating endothelial progenitor cells[J]. Br J Pharmacol, 2012, 167(7): 1506-1519. |
22 | Hu X, Liu S, Liu X, et al. DPP-4 (CD26) inhibitor sitagliptin exerts anti-inflammatory effects on rat insulinoma (RINm) cells via suppressing NF-κB activation[J]. Endocrine, 2017, 55(3): 754-763. |
23 | Kang W, Hu Z, Ge S. Healthy and inflamed gingival fibroblasts differ in their inflammatory response to Porphyromonas gingivalis lipopolysaccharide[J]. Inflammation, 2016, 39(5): 1842-1852. |
24 | Imamura T. The role of gingipains in the pathogenesis of periodontal disease[J]. J Periodontol, 2003, 74(1): 111-118. |
25 | Jeng JH, Chan CP, Ho YS, et al. Effects of butyrate and propionate on the adhesion, growth, cell cycle kinetics, and protein synthesis of cultured human gingival fibroblasts[J]. J Periodontol, 1999, 70(12): 1435-1442. |
26 | Van Dyke TE, Serhan CN. Resolution of inflammation: a new paradigm for the pathogenesis of periodontal diseases[J]. J Dent Res, 2003, 82(2): 82-90. |
27 | Makdissi A, Ghanim H, Vora M, et al. Sitagliptin exerts an antinflammatory action[J]. J Clin Endocrinol Metab, 2012, 97(9): 3333-3341. |
28 | Matsubara J, Sugiyama S, Sugamura K, et al. A dipeptidyl peptidase-4 inhibitor, des-fluoro-sitagliptin, improves endothelial function and reduces atherosclerotic lesion formation in apolipoprotein E-deficient mice[J]. J Am Coll Cardiol, 2012, 59(3): 265-276. |
29 | Esposito G, Cappetta D, Russo R, et al. Sitagliptin reduces inflammation, fibrosis and preserves diastolic function in a rat model of heart failure with preserved ejection fraction[J]. Br J Pharmacol, 2017, 174(22): 4070-4086. |
30 | Nauck MA, Meier JJ, Cavender MA, et al. Cardiovascular actions and clinical outcomes with glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors[J]. Circulation, 2017, 136(9): 849-870. |
31 | D'Aiuto F, Parkar M, Brett PM, et al. Gene polymorphisms in pro-inflammatory cytokines are associated with systemic inflammation in patients with severe periodontal infections[J]. Cytokine, 2004, 28(1): 29-34. |
32 | Moraes RM, Lima GM, Oliveira FE, et al. Exenatide and sitagliptin decrease interleukin 1β, matrix metalloproteinase 9, and nitric oxide synthase 2 gene expression but does not reduce alveolar bone loss in rats with periodontitis[J]. J Periodontol, 2015, 86(11): 1287-1295. |
33 | Bakker AD, Kulkarni RN, Klein-Nulend J, et al. IL-6 alters osteocyte signaling toward osteoblasts but not osteoclasts[J]. J Dent Res, 2014, 93(4): 394-399. |
34 | Noh MK, Jung M, Kim SH, et al. Assessment of IL-6, IL-8 and TNF-α levels in the gingival tissue of patients with periodontitis[J]. Exp Ther Med, 2013, 6(3): 847-851. |
35 | Wang Y, Andrukhov O, Rausch-Fan X. Oxidative stress and antioxidant system in periodontitis[J]. Front Physiol, 2017, 8: 910. |
36 | Aidoukovitch A, Anders E, Dahl S, et al. The host defense peptide LL-37 is internalized by human periodontal ligament cells and prevents LPS-induced MCP-1 production[J]. J Periodontal Res, 2019, 54(6): 662-670. |
37 | Tian Q, Stepaniants SB, Mao M, et al. Integrated genomic and proteomic analyses of gene expression in Mammalian cells[J]. Mol Cell Proteomics, 2004, 3(10): 960-969. |
38 | de Sousa Abreu R, Penalva LO, Marcotte EM, et al. Global signatures of protein and mRNA expression levels[J]. Mol Biosyst, 2009, 5(12): 1512-1526. |
39 | de Klerk E, 't Hoen PA. Alternative mRNA transcription, processing, and translation: insights from RNA sequencing[J]. Trends Genet, 2015, 31(3): 128-139. |
40 | Lawrence T. The nuclear factor NF-kappaB pathway in inflammation[J]. Cold Spring Harb Perspect Biol, 2009, 1(6): a001651. |
41 | Nichols TC, Fischer TH, Deliargyris EN, et al. Role of nuclear factor-kappa B (NF-kappa B) in inflammation, periodontitis, and atherogenesis[J]. Ann Periodontol, 2001, 6(1): 20-29. |
42 | Hao C, Wu B, Hou Z, et al. Asiatic acid inhibits LPS-induced inflammatory response in human gingival fibroblasts[J]. Int Immunopharmacol, 2017, 50: 313-318. |
43 | Ambili R, Santhi WS, Janam P, et al. Expression of activated transcription factor nuclear factor-kappaB in periodontally diseased tissues[J]. J Periodontol, 2005, 76(7): 1148-1153. |
44 | Lin CH, Lin CC. Sitagliptin attenuates inflammatory responses in lipopolysaccharide-stimulated cardiomyocy-tes via nuclear factor-κB pathway inhibition[J]. Exp Ther Med, 2016, 11(6): 2609-2615. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||