Sitagliptin inhibits lipopolysaccharide-induced inflammatory response in human gingival fibroblasts by blocking nuclear factor-κB signaling pathway

doi:10.7518/hxkq.2021.02.005

Abstract

Abstract: Objective

This study was performed to clarify the effects of sitagliptin on Porphyromonas gingivalis-lipopolysaccharide (LPS)-induced inflammatory response in human gingival fibroblasts (HGFs), explore the molecular mechanism of its roles, and provide a foundation for clinical therapeutics in periodontitis.

Methods

Healthy gingival samples were collected from the donors. HGFs were isolated with enzymic digestion method and identified. The effects of LPS and sitagliptin on cell viability were detected by cell-counting kit-8 (CCK8). The mRNA levels of inflammatory cytokines, namely, interleukin (IL)-6, IL-8, C-C motif ligand 2 (CCL2), and superoxide dismutase 2 (SOD2), were evaluated by quantity real-time polymerase chain reaction (qRT-PCR) and enzyme-linked immune sorbent assay (ELISA) was used to measure the secretion protein levels of IL-6, IL-8, and CCL2. Western blot analysis was used to further investigate the activation of nuclear factor (NF)-κB signaling pathway. The effect of NF-κB pathway inhibitor BAY11-7082 on LPS-induced HGF inflammatory cytokines at the gene level was verified by qRT-PCR.

Results

Low concentrations of sitagliptin (0.1, 0.25, and 0.5 μmol·L^-1) did not affect HGF growth in 24 and 48 h, whereas high concentrations of sitagliptin (5-1 000 μmol·L^-1) significantly inhibited cell proliferation. Sitagliptin suppressed 5 μg·mL^-1 of LPS-induced IL-6, IL-8, CCL2, and SOD2 gene expression levels in HGF in a concentration-dependent manner. Furthermore, sitagliptin significantly decreased the elevated secretion of IL-6, IL-8, and CCL2 protein induced by LPS. Western blot analysis showed that 0.5 μmol·L^-1 of sitagliptin significantly inhibited LPS-induced NF-κB signaling pathway activation. Results of qRT-PCR analysis indicated that 0.5 μmol·L^-1 of sitagliptin and 5 μmol·L^-1 of BAY11-7082 significantly inhibited LPS-induced IL-6, IL-8, CCL2, and SOD2 gene expressions.

Conclusion

Sitagliptin could significantly inhibit LPS-induced HGF inflammatory response by blocking the NF-κB signaling pathway activation.

Key words: Sitagliptin, lipopolysaccharide, nuclear factor-κB, inflammation, human gingival fibroblasts

CLC Number:

R 988.2

Liu Xiang, Kang Wenyan, Shang Lingling, Ge Shaohua. Sitagliptin inhibits lipopolysaccharide-induced inflammatory response in human gingival fibroblasts by blocking nuclear factor-κB signaling pathway[J]. West China Journal of Stomatology, 2021, 39(2): 153-163.

Figures/Tables 10

Tab 1

Fig 1

Fig 2

Fig 3

Fig 4

Fig 5

Fig 6

Fig 7

Fig 8

Fig 9

References 44

1	Ji S, Choi YS, Choi Y. Bacterial invasion and persistence: critical events in the pathogenesis of periodontitis[J]. J Periodontal Res, 2015, 50(5): 570-585.
2	Chapple IL, Matthews JB. The role of reactive oxygen and antioxidant species in periodontal tissue destruction[J]. Periodontol 2000, 2007, 43: 160-232.
3	Meyle J, Chapple I. Molecular aspects of the pathogenesis of periodontitis[J]. Periodontol 2000, 2015, 69(1): 7-17.
4	Laine ML, Crielaard W, Loos BG. Genetic susceptibility to periodontitis[J]. Periodontol 2000, 2012, 58(1): 37-68.
5	Bostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen[J]. FEMS Microbiol Lett, 2012, 333(1): 1-9.
6	Gölz L, Memmert S, Rath-Deschner B, et al. LPS from P. gingivalis and hypoxia increases oxidative stress in periodontal ligament fibroblasts and contributes to periodontitis[J]. Mediators Inflamm, 2014, 2014: 986264.
7	Kinane DF. Causation and pathogenesis of periodontal disease[J]. Periodontol 2000, 2001, 25: 8-20.
8	Wang PL, Azuma Y, Shinohara M, et al. Toll-like receptor 4-mediated signal pathway induced by Porphyromonas gingivalis lipopolysaccharide in human gingival fibroblasts[J]. Biochem Biophys Res Commun, 2000, 273(3): 1161-1167.
9	Trindade F, Oppenheim FG, Helmerhorst EJ, et al. Uncovering the molecular networks in periodontitis[J]. Proteomics Clin Appl, 2014, 8(9/10): 748-761.
10	Buckley CD, Pilling D, Lord JM, et al. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation[J]. Trends Immunol, 2001, 22(4): 199-204.
11	Ara T, Kurata K, Hirai K, et al. Human gingival fibroblasts are critical in sustaining inflammation in periodontal disease[J]. J Periodontal Res, 2009, 44(1): 21-27.
12	Buckley CD. Why does chronic inflammation persist: an unexpected role for fibroblasts[J]. Immunol Lett, 2011, 138(1): 12-14.
13	Wang Q, Zhang B, Yu JL. Farrerol inhibits IL-6 and IL-8 production in LPS-stimulated human gingival fibroblasts by suppressing PI3K/AKT/NF-κB signaling pathway[J]. Arch Oral Biol, 2016, 62: 28-32.
14	Damgaard C, Kantarci A, Holmstrup P, et al. Porphyromonas gingivalis-induced production of reactive oxygen species, tumor necrosis factor-α, interleukin-6, CXCL8 and CCL2 by neutrophils from localized aggressive periodontitis and healthy donors: modulating actions of red blood cells and resolvin E1[J]. J Periodontal Res, 2017, 52(2): 246-254.
15	Yoon Y, Kim TJ, Lee JM, et al. SOD2 is upregulated in periodontitis to reduce further inflammation progression[J]. Oral Dis, 2018, 24(8): 1572-1580.
16	Zerilli T, Pyon EY. Sitagliptin phosphate: a DPP-4 inhibitor for the treatment of type 2 diabetes mellitus[J]. Clin Ther, 2007, 29(12): 2614-2634.
17	Satoh-Asahara N, Sasaki Y, Wada H, et al. A dipeptidyl peptidase-4 inhibitor, sitagliptin, exerts anti-inflammatory effects in type 2 diabetic patients[J]. Metabolism, 2013, 62(3): 347-351.
18	Jiang W, Wen D, Cheng Z, et al. Effect of sitagliptin, a DPP-4 inhibitor, against DENA-induced liver cancer in rats mediated via NF-κB activation and inflammatory cytokines[J]. J Biochem Mol Toxicol, 2018, 32(12): e22220.
19	Vaghasiya J, Sheth N, Bhalodia Y, et al. Sitagliptin protects renal ischemia reperfusion induced renal damage in diabetes[J]. Regul Pept, 2011, 166(1/2/3): 48-54.
20	Omoto S, Taniura T, Nishizawa T, et al. Anti-atherosclerotic effects of sitagliptin in patients with type 2 diabetes mellitus[J]. Diabetes Metab Syndr Obes, 2015, 8: 339-345.
21	Huang CY, Shih CM, Tsao NW, et al. Dipeptidyl peptidase-4 inhibitor improves neovascularization by increasing circulating endothelial progenitor cells[J]. Br J Pharmacol, 2012, 167(7): 1506-1519.
22	Hu X, Liu S, Liu X, et al. DPP-4 (CD26) inhibitor sitagliptin exerts anti-inflammatory effects on rat insulinoma (RINm) cells via suppressing NF-κB activation[J]. Endocrine, 2017, 55(3): 754-763.
23	Kang W, Hu Z, Ge S. Healthy and inflamed gingival fibroblasts differ in their inflammatory response to Porphyromonas gingivalis lipopolysaccharide[J]. Inflammation, 2016, 39(5): 1842-1852.
24	Imamura T. The role of gingipains in the pathogenesis of periodontal disease[J]. J Periodontol, 2003, 74(1): 111-118.
25	Jeng JH, Chan CP, Ho YS, et al. Effects of butyrate and propionate on the adhesion, growth, cell cycle kinetics, and protein synthesis of cultured human gingival fibroblasts[J]. J Periodontol, 1999, 70(12): 1435-1442.
26	Van Dyke TE, Serhan CN. Resolution of inflammation: a new paradigm for the pathogenesis of periodontal diseases[J]. J Dent Res, 2003, 82(2): 82-90.
27	Makdissi A, Ghanim H, Vora M, et al. Sitagliptin exerts an antinflammatory action[J]. J Clin Endocrinol Metab, 2012, 97(9): 3333-3341.
28	Matsubara J, Sugiyama S, Sugamura K, et al. A dipeptidyl peptidase-4 inhibitor, des-fluoro-sitagliptin, improves endothelial function and reduces atherosclerotic lesion formation in apolipoprotein E-deficient mice[J]. J Am Coll Cardiol, 2012, 59(3): 265-276.
29	Esposito G, Cappetta D, Russo R, et al. Sitagliptin reduces inflammation, fibrosis and preserves diastolic function in a rat model of heart failure with preserved ejection fraction[J]. Br J Pharmacol, 2017, 174(22): 4070-4086.
30	Nauck MA, Meier JJ, Cavender MA, et al. Cardiovascular actions and clinical outcomes with glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors[J]. Circulation, 2017, 136(9): 849-870.
31	D'Aiuto F, Parkar M, Brett PM, et al. Gene polymorphisms in pro-inflammatory cytokines are associated with systemic inflammation in patients with severe periodontal infections[J]. Cytokine, 2004, 28(1): 29-34.
32	Moraes RM, Lima GM, Oliveira FE, et al. Exenatide and sitagliptin decrease interleukin 1β, matrix metalloproteinase 9, and nitric oxide synthase 2 gene expression but does not reduce alveolar bone loss in rats with periodontitis[J]. J Periodontol, 2015, 86(11): 1287-1295.
33	Bakker AD, Kulkarni RN, Klein-Nulend J, et al. IL-6 alters osteocyte signaling toward osteoblasts but not osteoclasts[J]. J Dent Res, 2014, 93(4): 394-399.
34	Noh MK, Jung M, Kim SH, et al. Assessment of IL-6, IL-8 and TNF-α levels in the gingival tissue of patients with periodontitis[J]. Exp Ther Med, 2013, 6(3): 847-851.
35	Wang Y, Andrukhov O, Rausch-Fan X. Oxidative stress and antioxidant system in periodontitis[J]. Front Physiol, 2017, 8: 910.
36	Aidoukovitch A, Anders E, Dahl S, et al. The host defense peptide LL-37 is internalized by human periodontal ligament cells and prevents LPS-induced MCP-1 production[J]. J Periodontal Res, 2019, 54(6): 662-670.
37	Tian Q, Stepaniants SB, Mao M, et al. Integrated genomic and proteomic analyses of gene expression in Mammalian cells[J]. Mol Cell Proteomics, 2004, 3(10): 960-969.
38	de Sousa Abreu R, Penalva LO, Marcotte EM, et al. Global signatures of protein and mRNA expression levels[J]. Mol Biosyst, 2009, 5(12): 1512-1526.
39	de Klerk E, 't Hoen PA. Alternative mRNA transcription, processing, and translation: insights from RNA sequencing[J]. Trends Genet, 2015, 31(3): 128-139.
40	Lawrence T. The nuclear factor NF-kappaB pathway in inflammation[J]. Cold Spring Harb Perspect Biol, 2009, 1(6): a001651.
41	Nichols TC, Fischer TH, Deliargyris EN, et al. Role of nuclear factor-kappa B (NF-kappa B) in inflammation, periodontitis, and atherogenesis[J]. Ann Periodontol, 2001, 6(1): 20-29.
42	Hao C, Wu B, Hou Z, et al. Asiatic acid inhibits LPS-induced inflammatory response in human gingival fibroblasts[J]. Int Immunopharmacol, 2017, 50: 313-318.
43	Ambili R, Santhi WS, Janam P, et al. Expression of activated transcription factor nuclear factor-kappaB in periodontally diseased tissues[J]. J Periodontol, 2005, 76(7): 1148-1153.
44	Lin CH, Lin CC. Sitagliptin attenuates inﬂammatory responses in lipopolysaccharide-stimulated cardiomyocy-tes via nuclear factor-κB pathway inhibition[J]. Exp Ther Med, 2016, 11(6): 2609-2615.

引物	序列（5’-3’）
GAPDH	上游：ACCACAGTCCATGCCATCAC 下游：ACCACCCTGTTGCTGTA
IL-6	上游：ATAACCACCCCTGACCCAAC 下游：CCCATGCTACATTTGCCGAA
IL-8	上游：TCAGAGACAGCAGAGCACAC 下游：GGCAAAACTGCACCTTCACA
CCL2	上游：CAGCCAGATGCAATCAATGCC 下游：TGGAATCCTGAACCCACTTCT
SOD2	上游：GGGATTGATGTGTGGGAGCA 下游：CATAAAGAGCTTAACATACTCAGCA

[1]	Tang Xiaoxue, Zhou Zheng, Li Qiqi, Jiang Dandan. Effects of sitagliptin activation of the stromal cell-derived factor-1/CXC chemokine receptor 4 signaling pathway on the proliferation, apoptosis, inflammation, and osteogenic differentiation of human periodontal ligament stem cells induced by lipopolysaccharide [J]. West China Journal of Stomatology, 2024, 42(1): 37-45.
[2]	Tang Meng, Cui Zhan-qin, Wang Yangyang, Chen Zengguo, Li Wenjing, Zhang Cuiping. Effects of low-level laser on the expression of interleukin-6, tumor necrosis factor‑α, osteoprotegerin, and receptor activator of nuclear factor-κB ligand in human periodontal ligament cells [J]. West China Journal of Stomatology, 2023, 41(5): 521-532.
[3]	Lu Ting, Zhu Jiahao, Yang Shihe, Shen Zhe, Zhong Liangjun. Effects of Foxp3 gene silencing on the expression of inflammatory cytokines and the proliferation and migration of human periodontal ligament fibroblasts in an inflammatory environment [J]. West China Journal of Stomatology, 2023, 41(3): 269-275.
[4]	Wu Jie, Cui Zhanqin, Han Yu, Li Wenjing. Aging effect of osteoprotegerin and receptor activator of nuclear factor-κB ligand expression in human periodontal ligament cells under continuous static pressure [J]. West China Journal of Stomatology, 2022, 40(6): 654-661.
[5]	Dai Zhenning, Zheng Weihan, Li Shiyu. Receptor activator of nuclear factor-κB ligand and tumor necrosis factor-α promotes osteoclast differentiation through the exosomes of inflammatory periodontal ligament stem cells [J]. West China Journal of Stomatology, 2022, 40(4): 377-385.
[6]	Luo Houzhuo, Fang Shishu, Liu Qian, Dang Wei, Wang Yanli. Comparison of interleukin expression in gingival crevicular fluid between patients with invisible orthodontics treat-ment and fixed orthodontics treatment [J]. West China Journal of Stomatology, 2022, 40(3): 293-296.
[7]	Zhang Xiujuan, Wu Wei, Chen Xin, Fang Zhichun, Ye Jinxiang, Ou Xiaoyan.. Effects of grape seed proanthocyanidins on the expression of inflammatory mediators in gingival epithelial cells [J]. West China Journal of Stomatology, 2022, 40(1): 39-44.
[8]	Zhu Jianhui, Zheng Xin, Peng Xian, Xu Xin, Margolskee Robert, Zhou Xuedong. Regulation effect of lipopolysaccharide on the alternative splicing and function of sweet taste receptor T1R2 [J]. West China Journal of Stomatology, 2021, 39(4): 469-474.
[9]	Jin Xiaolan, Zhang Yanan, Sun Chengrui, Zou Zhaohui. Protective effect of low-level laser irradiation on lipopolysaccharide-mediated inflammatory injury of human periodontal ligament fibroblasts [J]. West China Journal of Stomatology, 2021, 39(3): 260-266.
[10]	Si Yuting, Song Jinhua, Fang Zhen, Han Xiaozhe, Jiang Shaoyun. MicroRNA-146a regulates the production of cytokines in lymphocytes stimulated by Porphyromonas gingivalis lipopolysaccharide [J]. West China Journal of Stomatology, 2021, 39(1): 26-31.
[11]	Liu Yinchen. Developments of specialized pro-resolving mediators in periodontitis [J]. West China Journal of Stomatology, 2021, 39(1): 94-98.
[12]	Liao Min, Cheng Lei, Zhou Xuedong, Ren Biao. Research progress of Candida albicans on malignant transformation of oral mucosal diseases [J]. West China Journal of Stomatology, 2020, 38(4): 431-437.
[13]	Ouyang Yuling, Chen Sheng, Chen Bin. Differences of B cells, plasma cells, and related cytokines expression in gingival tissues between periodontitis and periodontal healthy subjects [J]. West China Journal of Stomatology, 2020, 38(3): 250-255.
[14]	Zhu Jie,Tang Yi,Wu Qing,Ji Yingchen,Kang Feiwu. Mechanism of participation of osteocytes in the formation of osteoclasts under hypoxia [J]. West China Journal of Stomatology, 2019, 37(5): 463-468.
[15]	Lin Yongsheng,Wang Fengzhi,Lei Xiaojing,He Jianmin. Comparative study with the effect of stromal cell derived factor-1 on osteogenic differentiation of human healthy and inflammatory periodontal ligament stem cells [J]. West China Journal of Stomatology, 2019, 37(5): 469-475.