Effect of hypoxia on the biological characteristics of human dental follicle cells

doi:10.7518/hxkq.2017.03.004

Abstract

Abstract:

Objective This study aimed to investigate the effects of hypoxia on the characteristics of human dental follicle cells (hDFCs). Methods The tissue explant collagenase method was used to isolate hDFCs from young permanent teeth. The immunofluorescence technique was used to detect cell surface markers, and the multi-differentiation potential was detected by multilineage differentiation induction assay. Then, the hypoxic microenvironment was physically mimicked, and the cells were divided into the normoxia group (20%O₂) and the hypoxia group (2%O₂). The effects of hypoxia on cell migration and proliferation were examined by Transwell chamber test and CCK-8 assay, respectively. The gene and protein expression levels of stemness-related markers at both oxygen concentrations were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot, respectively. After osteogenic induction of both groups, qRT-PCR was performed to evaluate the osteogenesis-related gene, and alizarin red staining was used to assess the formation of mineralized nodules. Results With the multi-differentiation capacity of osteogenic cells, adipogenic cells, and nerves, hDFCs demonstrate strong stem cell characteristics and possess the criteria of mesenchymal stem cells, which can meet the requirements of seed cells in dental tissue engineering. Hypoxia was conducive to the maintenance of hDFC stemness. Hypoxia promoted the migration and proliferation of hDFCs. The hDFCs were induced to osteogenic differentiation under hypoxic conditions, thereby enhancing osteogenesis. Conclusion Hypoxic microenvi-ronment plays an important role in maintaining the stemness and promoting the proliferation, migration, and differentiation of hDFCs. Thus, this microenvironment could also serve several important functions in future clinical applications.

Key words: hypoxia, human dental follicle cells, proliferation, migration, differentiation

CLC Number:

R 780.2

Xi Liang, Guoqing Chen, Wei-dong Tian. Effect of hypoxia on the biological characteristics of human dental follicle cells[J]. West China Journal of Stomatology, 2017, 35(3): 245-252.

Figures/Tables 7

Tab 1

Fig 1

Fig 2

Fig 3

Fig 4

Fig 6

References 40

[1]	Morsczeck C, Götz W, Schierholz J, et al.Isolation of pre-cursor cells (PCs) from human dental follicle of wisdom teeth[J]. Matrix Biol, 2005, 24(2):155-165.
[2]	Saito M, Handa K, Kiyono T, et al.Immortalization of cemen-toblast progenitor cells with Bmi-1 and TERT[J]. J Bone Miner Res, 2005, 20(1):50-57.
[3]	Guo W, Gong K, Shi H, et al.Dental follicle cells and treated dentin matrix scaffold for tissue engineering the tooth root[J]. Biomaterials, 2012, 33(5):1291-1302.
[4]	Grayson WL, Zhao F, Izadpanah R, et al.Effects of hypoxia on human mesenchymal stem cell expansion and plasticity in 3D constructs[J]. J Cell Physiol, 2006, 207(2):331-339.
[5]	Bosch P, Pratt SL, Stice SL.Isolation, characterization, gene modification, and nuclear reprogramming of porcine mesen-chymal stem cells[J]. Biol Reprod, 2006, 74(1):46-57.
[6]	Mazumdar J, Dondeti V, Simon MC.Hypoxia-inducible factors in stem cells and cancer[J]. J Cell Mol Med, 2009, 13(11/12):4319-4328.
[7]	Webb JD, Coleman ML, Pugh CW.Hypoxia, hypoxia-in-ducible factors (HIF), HIF hydroxylases and oxygen sensing[J]. Cell Mol Life Sci, 2009, 66(22):3539-3554.
[8]	Iida K, Takeda-Kawaguchi T, Tezuka Y, et al.Hypoxia en-hances colony formation and proliferation but inhibits diffe-rentiation of human dental pulp cells[J]. Arch Oral Biol, 2010, 55(9):648-654.
[9]	Sakdee JB, White RR, Pagonis TC, et al.Hypoxia-amplified proliferation of human dental pulp cells[J]. J Endod, 2009, 35(6):818-823.
[10]	Gong QM, Quan JJ, Jiang HW, et al.Regulation of the stro-mal cell-derived factor-1alpha-CXCR4 axis in human dental pulp cells[J]. J Endod, 2010, 36(9):1499-1503.
[11]	Aranha AM, Zhang Z, Neiva KG, et al.Hypoxia enhances the angiogenic potential of human dental pulp cells[J]. J En-dod, 2010, 36(10):1633-1637.
[12]	Agata H, Kagami H, Watanabe N, et al.Effect of ischemic culture conditions on the survival and differentiation of porcine dental pulp-derived cells[J]. Differentiation, 2008, 76(9):981-993.
[13]	Guo L, Li J, Qiao X, et al.Comparison of odontogenic diffe-rentiation of human dental follicle cells and human dental papilla cells[J]. PLoS ONE, 2013, 8(4):e62332.
[14]	Guo S, Guo W, Ding Y, et al.Comparative study of human dental follicle cell sheets and periodontal ligament cell sheets for periodontal tissue regeneration[J]. Cell Transplant, 2013, 22(6):1061-1073.
[15]	Li R, Guo W, Yang B, et al.Human treated dentin matrix as a natural scaffold for complete human dentin tissue rege-neration[J]. Biomaterials, 2011, 32(20):4525-4538.
[16]	Patil R, Kumar BM, Lee WJ, et al.Multilineage potential and proteomic profiling of human dental stem cells derived from a single donor[J]. Exp Cell Res, 2014, 320(1):92-107.
[17]	Sung IY, Son HN, Ullah I, et al.Cardiomyogenic differentia-tion of human dental follicle-derived stem cells by suberoy-lanilide hydroxamic acid and their in vivo homing property[J]. Int J Med Sci, 2016, 13(11):841-852.
[18]	Kashyap V, Rezende NC, Scotland KB, et al.Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluri-potency transcription factors with polycomb repressive com-plexes and stem cell microRNAs[J]. Stem Cells Dev, 2009, 18(7):1093-1108.
[19]	Park IH, Zhao R, West JA, et al.Reprogramming of human somatic cells to pluripotency with defined factors[J]. Nature, 2008, 451(7175):141-146.
[20]	Mathieu J, Zhang Z, Zhou W, et al.HIF induces human em-bryonic stem cell markers in cancer cells[J]. Cancer Res, 2011, 71(13):4640-4652.
[21]	Miura M, Gronthos S, Zhao M, et al.SHED: stem cells from human exfoliated deciduous teeth[J]. Proc Natl Acad Sci USA, 2003, 100(10):5807-5812.
[22]	Tamaki Y, Nakahara T, Ishikawa H, et al.In vitro analysis of mesenchymal stem cells derived from human teeth and bone marrow[J]. Odontology, 2013, 101(2):121-132.
[23]	Kerkis I, Kerkis A, Dozortsev D, et al.Isolation and charac-terization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers[J]. Cells Tissues Organs, 2006, 184(3/4):105-116.
[24]	Sheik Mohamed J, Gaughwin PM, Lim B, et al.Conserved long noncoding RNAs transcriptionally regulated by Oct4 and Nanog modulate pluripotency in mouse embryonic stem cells[J]. RNA, 2010, 16(2):324-337.
[25]	Brunelle JK, Shroff EH, Perlman H, et al.Loss of Mcl-1 pro-tein and inhibition of electron transport chain together induce anoxic cell death[J]. Mol Cell Biol, 2007, 27(4):1222-1235.
[26]	Zhou Y, Fan W, Xiao Y.The effect of hypoxia on the stem-ness and differentiation capacity of PDLC and DPC[J]. Bio-med Res Int, 2014:890675.
[27]	Keith B, Simon MC.Hypoxia-inducible factors, stem cells, and cancer[J]. Cell, 2007, 129(3):465-472.
[28]	Kanafi MM, Ramesh A, Gupta PK, et al.Influence of hypo-xia, high glucose, and low serum on the growth kinetics of mesenchymal stem cells from deciduous and permanent teeth[J]. Cells Tissues Organs, 2013, 198(3):198-208.
[29]	Dai Y, He H, Wise GE, et al.Hypoxia promotes growth of stem cells in dental follicle cell populations[J]. J Biomed Sci Eng, 2011, 4(6):454-461.
[30]	Komori T.Runx2, a multifunctional transcription factor in skeletal development[J]. J Cell Biochem, 2002, 87(1):1-8.
[31]	Matsubara T, Kida K, Yamaguchi A, et al.BMP2 regulates Osterix through Msx2 and Runx2 during osteoblast differen-tiation[J]. J Biol Chem, 2008, 283(43):29119-29125.
[32]	Nakashima K, Zhou X, Kunkel G, et al.The novel zinc finger-containing transcription factor osterix is required for osteo-blast differentiation and bone formation[J]. Cell, 2002, 108(1):17-29.
[33]	Huang W, Yang S, Shao J, et al.Signaling and transcrip-tional regulation in osteoblast commitment and differentia-tion[J]. Front Biosci, 2007, 12:3068-3092.
[34]	Annabi B, Lee YT, Turcotte S, et al.Hypoxia promotes mu-rine bone-marrow-derived stromal cell migration and tube formation[J]. Stem Cells, 2003, 21(3):337-347.
[35]	Leijten J, Georgi N, Moreira Teixeira L, et al.Metabolic pro-gramming of mesenchymal stromal cells by oxygen tension directs chondrogenic cell fate[J]. Proc Natl Acad Sci U S A, 2014, 111(38):13954-13959.
[36]	Ren H, Cao Y, Zhao Q, et al.Proliferation and differentiation of bone marrow stromal cells under hypoxic conditions[J]. Biochem Biophys Res Commun, 2006, 347(1):12-21.
[37]	Prado-Lòpez S, Duffy MM, Baustian C, et al.The influence of hypoxia on the differentiation capacities and immunosup-pressive properties of clonal mouse mesenchymal stromal cell lines[J]. Immunol Cell Biol, 2014, 92(7):612-623.
[38]	Lee JS, Park JC, Kim TW, et al.Human bone marrow stem cells cultured under hypoxic conditions present altered cha-racteristics and enhanced in vivo tissue regeneration[J]. Bone, 2015, 78:34-45.
[39]	Grayson WL, Zhao F, Bunnell B, et al.Hypoxia enhances proliferation and tissue formation of human mesenchymal stem cells[J]. Biochem Biophys Res Commun, 2007, 358(3):948-953.
[40]	Lin D, Zhou L, Wang B, et al.Overexpression of HIF-1α in mesenchymal stem cells contributes to repairing hypoxic-ischemic brain damage in rats[J]. C R Biol, 2017, 340(1):18-24.

基因	引物序列（5’—3’）
β-actin	F：AGCCTCGCCTTTGCCG
	R：CTCGTCGCCCACATAGGAAT
Nanog	F：TGGACACTGGCTGAATCCTTC
	R：CGCTGATTAGGCTCCAACCAT
Sox-2	F：CAGCTCGCAGACCTACATGAAC
	R：CTGGAGTGGGAGGAAGAGGTAAC
Oct-4	F：TCCCATGCATTCAAACTGAGG
	R：CCAAAAACCCTGGCACAAACT
Runx2	F：CTTTACTTACACCCCGCCAGTC
	R：AGAGATATGGAGTGCTGCTGGTC
OSX	F：TCAACAACTCTGGGCAAAGCA
	R：TTAGCATAGCCTGAGGTGGGTG
BSP	F：CGAACAAGGCATAAACGGCACCAG
	R：TTCTCCATTGTCTCCTCCGCTGCT
OPN	F：CAGTTGTCCCCACAGTAGACAC
	R：GTGATGTCCTCGTCTGTAGCATC